Labshake search
Citations for Addgene :
451 - 500 of 1080 citations for Recombinant Human MMP2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR–Cas9 screen was performed using the whole genome human Brunello CRISPR knockout pooled library (Addgene #73178) (PMID ...
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2023Quote: ... human RXRa cDNA was PCR-amplified from pSV-Sport-RXRα (a gift from Bruce Spiegelman; Addgene #8882)68 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Reads were then mapped to a FASTA file generated from the Bassik Human CRISPR Knockout Library (Addgene), clipped to remove one nucleotide at the 5’ end of each read (due to an excess of mismatches at this position) ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid containing iGluSnFR(A184S) under the control of the human synapsin promoter was purchased from Addgene (#106174) and packaged in the AAV8-Y733F serotype 55 ...
-
bioRxiv - Cell Biology 2023Quote: ... a human colon line (HUB-02-A2-040) was lentivirally transduced with pGK Dest H2B-miRFP670 (Addgene). Lentiviral transduction was performed on single cells after 0.05% Trypsin EDTA (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: Human OGG1 WT or OGG1 K249Q in a pET-His6-GFP-TEV bacterial expression vector (Addgene #29663) were obtained from GenScript ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids for nanobody fusion protein expression are deposited with Addgene (Addgene: #109417 ...
-
bioRxiv - Genetics 2020Quote: ... R47H TREM2 or GFP proteins (Addgene; pCW57-GFP-2A-MCS, #71783). After 2-weeks of puromycin selection ...
-
bioRxiv - Cell Biology 2021Quote: Protein expression vector pET28a-mCherry-CNA35 was obtained from Addgene (#61607). Transformed E.coli (BL21 ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2021Quote: ... The fusion protein was cloned into pAAV-CAG-GFP (Addgene #37825) by substituting the GFP with H2B- mGreenLantern using restriction enzymes BamHI and XhoI ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Neuroscience 2022Quote: ... and a PCR amplicon containing the CRISPRoff-v2.1 protein from Addgene plasmid 167981 (gifted from Luke Gilbert [45] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Genomics 2021Quote: ... and Protein AG (pAG) was amplified from pAG/MNase (ASP4154, Addgene plasmid #123461 ...
-
bioRxiv - Neuroscience 2022Quote: ... and a plasmid containing the Rep/Cap proteins (Addgene Plasmid #112862) using polyethylenimine (Polysciences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Neuroscience 2023Quote: ... Fusion protein ProteinA-Tn5 was prepared in-house (plasmid Addgene #124601) by following a previously described protocol 33 ...
-
bioRxiv - Neuroscience 2024Quote: ... The chimeric Gqi9 protein was ordered from Addgene (Plasmid No. 125711). This was then further modified using PCR and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: Biotinylated proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Molecular Biology 2019Quote: ... wildtype or BRCA2-knockout HeLa cells were transduced with the Brunello Human CRISPR knockout pooled library (Addgene, 73179).10 To achieve a representation of 250 cells per sgRNA ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral particles were produced in the Human Embryonic Kidney 293T (HEK293T) cell line with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full-length wild-type cDNA of human BRCA2 was subcloned from pcDNA3 236HSC WT (Addgene plasmid # 16246) into the piggyBac vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... Briefly three different sgRNAs targeting human SAMHD1 were designed and cloned into lentiCRISPR v2 vector (Addgene plasmid # 52961). Packaging 293T cells were transfected with SAMHD1 sgRNAs (CRISPR SAMHD1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207; http://n2t.net/addgene:22207; RRID:Addgene_22207).
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Microbiology 2021Quote: The human genome-wide Brunello Library (Doench et al., 2016) in lentiCRISPRv2 was obtained from Addgene (cat# 73179) and amplified according to depositor’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Microbiology 2020Quote: ... Human CRISPRi pooled library (Dolcetto) was a gift from John Doench (Broad Institute, also available on Addgene #92385). For the secondary screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the optimized sgRNA lentiviral expression vector (LRG2.1T) and the lentiviral human codon-optimized Streptococcus pyogenes Cas9 vector (LentiV_Cas9_Puro, Addgene: 108100) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2022Quote: ... human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cat. No. 44719). Two chimeric guide RNA expression cassettes containing two of the following sgRNAs (sgRNA1 ...