Labshake search
Citations for Addgene :
451 - 500 of 873 citations for Recombinant Human Long Arg3 Insulin like Growth Factor I since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Microbiology 2023Quote: The human CUL1 and UBE2L3 coding sequences were amplified from pcDNA-HA-UBE2L3 (Addgene, #27561) and pcDNA-myc3-CUL1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... GFP ORF was PCR-amplified and cloned between AgeI and EcoRI sited of lentiviral vector with synapsin I promoter (Addgene #20945). During this cloning AgeI site was destroyed and a new AgeI was introduced on a PCR primer downstream of GFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... an oligo duplex encoding the sgRNA sequence was cloned at the Bbs I site of pX458-pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). To construct a donor vector ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Systems Biology 2022Quote: ... Transfection with siRNA or the RFP-tagged protein of interest was performed 12 hours prior to transfection with I-SceI (Addgene #26477) or GFP control (Addgene #89684) ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Cell Biology 2023Quote: ... This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) [16] ...
-
bioRxiv - Cancer Biology 2023Quote: ... the I-SceI-P2A-mCherry plasmid which we generated by replacing AmCyan with I-SceI in the bicistronic plasmid Amcyan-P2A-mCherry (Addgene #45350) was delivered by nucleofection after 24 hours ...
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... and mito-PDCD10-mScarlet-I (mito-PDCD10) constructs were created by inserting a custom gene block (IDT) in the pMTS-mScarlet-I-N1 plasmid (Addgene 85059) using the XhoI/EcoRI sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reference sgRNA library sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Cancer Biology 2020Quote: ... then the human codon optimized Cas13a coding sequence amplified from the pC013-Twinstrep-SUMO-huLwCas13a (Addgene) by PCR was cloned into pMD19-T-DMP to obtain pMD19-T-DMP-Cas13a,next the chemically synthesized U6 promoter sequence and the direct repeat sequence of guide RNA of Cas13a separated by BbsI restriction sites were cloned into pMD19-T-DMP-Cas13a ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Molecular Biology 2022Quote: Genome-wide CRISPR screening was performed using the Human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048). For sgRNA library transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids containing the coding sequences of human SLC46A1 (pDONR221_SLC46A1) and SLC46A3 (pDONR221_SLC46A3) were purchased from Addgene. Custom plasmids (pTwist-CMV ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985 ...
-
bioRxiv - Neuroscience 2019Quote: ... ORFs from the human ORFeome collection were cloned into the pLEX307 destination plasmid (Addgene cat# 41392) using the standard LR clonase protocol (Thermo Fischer Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Cancer Biology 2021Quote: Neonatal human dermal fibroblasts (HDFns) were transduced with lentiviruses containing pCHAC-mt-mKeima (Addgene plasmid #72342) (Lazarou et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the human CAV1 fragment was further moved into a pET28-MBP-TEV plasmid (Addgene No. 69929) described in (37 ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a pair of single guide RNAs (sgRNA) targeting human TROP2 were inserted into lentiCRISPRv2 (Addgene, # 98293) and corresponding oligonucleotides were inserted into the pARv-RFP reporter vector (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Developmental Biology 2022Quote: ... A plasmid containing the full-length human FOS cDNA (NM_005252.4) was purchased from Addgene (Plasmid #59140). The full-length FOS cDNA was cloned into the pCS2 vector and FOS mRNA was generated using the mMessage mMachine Sp6 kit (Ambion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual gRNAs (Table S2) against murine and human SMARCA4 were cloned into pLentivectorCRISPR v2 (52961, Addgene). Non-target control (NTC ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgi localisation signal (residues 3131 to 3259 of Human Giantin) was extracted by PCR from Addgene’s plasmid #85048 ...
-
bioRxiv - Cell Biology 2023Quote: Lysosome localisation signal (residues 27 to 407 of Human LAMP1) was extracted by PCR from Addgene’s plasmid #55308 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human PD-L1-GFP (pEGFP-N1/PD-L1) was a gift from Mien-Chie Hung (Addgene plasmid # 121478 ...
-
bioRxiv - Biochemistry 2023Quote: ... The human Archease gene spanning residues 27-168 was inserted into the 2M-T (Addgene: 29708) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid pET-TRSter for heterologous expression of human thioredoxin reductase (hTrxR) was purchased from Addgene. Plasmids for wt and mutant DJ-1 were obtained from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CD68 promoter and enhancer (hCD68, ∼800 bp) was subcloned from pcDNA3-hCD68prm (Addgene #34837). The mouse F4/80 promoter (mF4/80 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...