Labshake search
Citations for Addgene :
101 - 150 of 1365 citations for Recombinant Human LDLR Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Cell Biology 2020Quote: ... while eIF4A was tagged using pML107 (Addgene: 67639). Both plasmids included an ampicillin resistance gene ...
-
bioRxiv - Biochemistry 2021Quote: ... HA tagged USP5 (#22590) was purchased from Addgene and subcloned into pcDNA5 mammalian expression vector ...
-
bioRxiv - Cell Biology 2022Quote: ... together with HA-tagged Raptor (Plasmid #8513, Addgene). 36 h post-transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... His14-Tev-tagged SENPEuB protease (Addgene ID #149333) was expressed in E ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139112)
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139116)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139117)
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Neuroscience 2019Quote: ... Similar experiments were conducted using mammalian PSD-95 protein (prepared by transfecting expression vectors pCMV-PSD95-flag [FLAG-tagged; Addgene, #15463] into HEK293 cells) bound to GluN2B-peptide-containing Agarose resins ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang[16]) or BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Molecular Biology 2019Quote: ... MmEsco2-myc/his and H2B-mCherry were amplified from the vectors pcDNA3.1/myc-His and pcDNA3-H2B-mCherry (Addgene, 20972), respectively ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Plant Biology 2021Quote: ... and Cas9 RNP nucleofection were performed according to Huang et al.30 Cas9 recombinant protein was overexpressed in Escherichia coli BL21 harboring the plasmid pMJ915 (Addgene # 69090). Cas9 protein was purified and stored at −80°C in Cas9 RNP buffer (20 mM HEPES at pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139124, 139125 respectively)
-
bioRxiv - Biochemistry 2021Quote: ... pFastBac1 His-MBP (#30116) were procured from Addgene. pNIC28-MBP was constructed by replacement of TrxT with MBP [22] ...
-
bioRxiv - Bioengineering 2022Quote: ... the plasmid pET-28b-Cas9-His (Addgene #47327) was transformed into Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Cas9 protein was produced by the Weizmann Institute of Science Protein Purification Unit using the pET-28b-Cas9-His (Alex Schier Lab Plasmids, Addgene, Cambridge, MA, United States) as a template ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: FLAG tagged ubiquitin was cloned in pCW57.1 vector (Addgene # 41393) between BsrG1 sites and verified through sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... T7-tagged p65 WT and mutants were purchased from Addgene: T7-RelA (#21984) ...
-
bioRxiv - Cell Biology 2023Quote: GFP tagged WT Keratin 8 in pEGFP-N3 (Addgene 6080) was kindly provided by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-tagged CLIMP63 (gift from Gia Voeltz 52, Addgene, 136293),mcherry-FIS1 (gift from Uri Manor53) ...
-
bioRxiv - Molecular Biology 2023Quote: ... C-terminally AcGFP-tagged SOD1 variants SOD1-WT (Addgene: #264074) and SOD1-G85R (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: His6-tagged MSP1D1 and MSPE3D1 (Addgene plasmids #20061 and #20066) were expressed in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... HA-tagged SOX4 [43] or empty vector control (Addgene 12257). SMARCA4 was overexpressed by WT SMARCA4-sfGFP (Addgene 107056 ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... the pET-28b-RfxCas13d-His vector (Addgene, Plasmid #141322) was used for RfxCas13d protein production (Bon Opus Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... The FLAG-His sequence in payload plasmid pKM491 (Addgene) was replaced with sequence for a 3×FLAG tag by Gibson Assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139126, 139127, 139128)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139114, 139115 respectively)
-
bioRxiv - Cell Biology 2023Quote: ... pET-His-GST-tev-LIC (Addgene #29655, Gradia Lab), pGEX-4T-3-mR7BD (Addgene #79149 ...