Labshake search
Citations for Addgene :
51 - 100 of 1022 citations for Recombinant Human LDLR His tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells transiently co-expressing individual GFP-tagged RUSH reporter and GalT-mCherry were cultured in complete DMEM supplemented with16 nM His-tagged streptavidin (in-house purified using Addgene #20860, a gift plasmid from A. Ting)(Howarth et al. ...
-
bioRxiv - Biophysics 2020Quote: The plasmid coding for human EGFR tagged with EGFP (hEGFR-EGFP) was a kind gift from Alexander Sorkin (Addgene plasmid #32751) (27) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression vector for 3xFLAG-tagged human MGA produced by the laboratory of Guntram Suske was purchased from Addgene (#107715) and modified by overlap extension PCR to remove residues 1052-3065.
-
bioRxiv - Cancer Biology 2023Quote: ... (NM_004458) Human Tagged ORF Clone (cat# RC205356) plasmids and cloned into a 3rd generation lentiviral vector PLJM1-EGFP (Addgene, cat# 19319). The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pEZYmyc-HIS (Addgene, #18701) or pDEST-myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... ITGA2-HIS (Addgene, #51910), ITGB2-YFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eps15-GFP-His (Addgene #170860 ...
-
bioRxiv - Cell Biology 2022Quote: ... Flag-tagged mTOR (Plasmid #26603) and HA-tagged Raptor (Plasmid #8513) were purchased from Addgene. Transfection were performed with the TransIT-X2 Transfection Reagent (Cat ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2023Quote: ... proteins were generated by sub cloning HA-tagged human TRIM71 and its mutant variants sequences from pMXS-hs-3xHA-TRIM71 (Addgene, no. 52717), pMXs-hs-3xHA-deltaRING-TRIM71 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Cell Biology 2023Quote: ... a donor plasmid pAAVS1-TRE3G-NGN2 was generated by replacing the EGFP sequence with N-terminal flag-tagged human NGN2 cDNA sequence in plasmid pAAVS1-TRE3G-EGFP (Addgene plasmid # 52343). 5μg of pAAVS1-TRE3G-NGN2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-tagged cytosolic APEX2 (Addgene, 49386) was then amplified by polymerase chain reaction (PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... Myc-tagged DNTCF4 plasmids (Addgene, #32729) were transiently transfected into targeted cells for a total of 24 hours before being subjected to the wound scratch assay.
-
bioRxiv - Cell Biology 2022Quote: ... Flag-tagged SMAD4 (#80888, Addgene®), and HA tagged TAZ (#32839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... The pMEL16 (His-, Addgene 107922) and p414-TEF1p-Cas9-CYC1t (hereafter referred to as P414 ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Cancer Biology 2021Quote: ... The pcDNA FLAG-tagged CRTC2 (#22975) and FLAG-tagged CRTC3 (22976) expression constructs were obtained from Addgene (38).
-
bioRxiv - Cancer Biology 2020Quote: ... and RFP-tagged histone H2B (Addgene#26001) expressing plasmids were obtained from Addgene or DNASU as indicated ...
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG/HA-tagged AGO1 (Addgene plasmid #10820), AGO2 (Addgene plasmid #10822) ...
-
bioRxiv - Cell Biology 2022Quote: ... and HA tagged TAZ (#32839, Addgene®) cloned into pcDNA ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... pcDNA3.1-Flag-His-ATM (Addgene 31985), pcDNA3.1-mCherry-NLRP3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SERPINE1-bio-his (Addgene #52077) which were gifts from Gavin Wright without signal sequence to prevent cleavage of fused proteins (75) ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... while eIF4A was tagged using pML107 (Addgene: 67639). Both plasmids included an ampicillin resistance gene ...
-
bioRxiv - Biochemistry 2021Quote: ... HA tagged USP5 (#22590) was purchased from Addgene and subcloned into pcDNA5 mammalian expression vector ...
-
bioRxiv - Cell Biology 2022Quote: ... together with HA-tagged Raptor (Plasmid #8513, Addgene). 36 h post-transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... His14-Tev-tagged SENPEuB protease (Addgene ID #149333) was expressed in E ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139112)
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139116)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139117)
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang[16]) or BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Molecular Biology 2019Quote: ... MmEsco2-myc/his and H2B-mCherry were amplified from the vectors pcDNA3.1/myc-His and pcDNA3-H2B-mCherry (Addgene, 20972), respectively ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...