Labshake search
Citations for Addgene :
451 - 500 of 872 citations for Recombinant Human Interleukin 6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Neuroscience 2021Quote: The immortalized human Schwann iHSC-1λ were infected with lentivirus derived from pLentiCRISPRv2 puro (Addgene, Cat#78852) expressing Cas9 and either a scrambled gRNA or one directed against the human NF1 gene designed to cleave between amino acids 157 and 158 in Exon 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178). The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Bioengineering 2020Quote: ... we used the human codon optimized Cas9 from lentiCRISPR v2 plasmid (Addgene 52961, Sanjana et al., 2014) as background for xCas9 and Cas9-NG mutations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E. Perez-Reyes, Addgene #45810 (Gomora et al. 2002) in combination with green fluorescent protein.
-
bioRxiv - Cell Biology 2019Quote: ... lentiviruses were produced by transfecting human embryonic kidney (HEK)-293T cells with psPAX2 and pMD2.G (Addgene) and pLVX-puro-GFP-Lifeact viral vectors ...
-
bioRxiv - Neuroscience 2019Quote: Myc-Par3 was created by subcloning human myc-Par3 from the pK-myc-Par3b plasmid (Addgene #19388) into the peGFP-N2 vector as described above using BamHI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Cell Biology 2020Quote: Human Rab21 (aa 16-225) constructs were cloned into a Gateway destination vector pgLAP1 (Addgene plasmid #19702) to express Rab21 with an N-terminal GFP followed by a TEV cleavage site and an S-Tag in mammalian cells ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR–Cas9 screen was performed using the whole genome human Brunello CRISPR knockout pooled library (Addgene #73178) (PMID ...
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2023Quote: ... human RXRa cDNA was PCR-amplified from pSV-Sport-RXRα (a gift from Bruce Spiegelman; Addgene #8882)68 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid containing iGluSnFR(A184S) under the control of the human synapsin promoter was purchased from Addgene (#106174) and packaged in the AAV8-Y733F serotype 55 ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Biochemistry 2023Quote: Human OGG1 WT or OGG1 K249Q in a pET-His6-GFP-TEV bacterial expression vector (Addgene #29663) were obtained from GenScript ...
-
bioRxiv - Cell Biology 2023Quote: ... a human colon line (HUB-02-A2-040) was lentivirally transduced with pGK Dest H2B-miRFP670 (Addgene). Lentiviral transduction was performed on single cells after 0.05% Trypsin EDTA (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... Reads were then mapped to a FASTA file generated from the Bassik Human CRISPR Knockout Library (Addgene), clipped to remove one nucleotide at the 5’ end of each read (due to an excess of mismatches at this position) ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Systems Biology 2020Quote: ... annealed oligonucleotides (Supplementary Table 6) were cloned into a BsaI site of a gRNA expression vector (Addgene Plasmid number 41824) 65 and correct insertion was determined by Sanger sequencing with the SP6 primer (Supplementary Table 6) ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid containing codon-optimized GAL80 sequence driven by a tubulin promoter is a gift from Allison Bardin and corresponds to the combination of pattB-tubP-SV40 - generated by Lee and Luo (Lee and Luo, 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Neuroscience 2023Quote: ... The following viruses were injected:: AAV5-hSyn-DIO-hM3Dq-mCherry (DREADD-Gq, titer 6 × 1012 cfu/ml, 250ul bilateral, #44361, Addgene), AAV5-hSyn-DIO-mCherry (control ...
-
bioRxiv - Neuroscience 2023Quote: For Synaptic plasticity experiments C57Bl/6-Jax mice were injected with AAV-Chronos (pAAV-Syn-Chronos-GFP, Addgene 59170-AAV5) virus in area S2 at locations and concentrations given in Table M2.