Labshake search
Citations for Addgene :
301 - 350 of 1097 citations for Recombinant Human Interleukin 13 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Neuroscience 2022Quote: ... injected bilaterally in Gpe with a retrogradely transported Cre-expressing AAV (350nl AAVrg-hsyn-Cre-eGFP, titer 1.3 x 10^13, Addgene 105540) (AP ...
-
bioRxiv - Cell Biology 2020Quote: New GOLGB1 KO cell lines with mutations in exon 13 were generated using the lentiCRISPRv2 system (lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.4) we infused 450nL of pAAV5- Ef1a-DIO-(hChR2-E123A)-eYFP (Addgene-ChR2 & eYFP titre: 2.2x10^13 GC/mL)76 ...
-
bioRxiv - Neuroscience 2022Quote: ... Vgat-ires-Cre mice were injected with AAV5/pAAV-EF1a-DIO-hChR2(H134R)-mCherry (Addgene, titer of 1.4×10^13) at left MPO (AP -3.1 mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Molecular Biology 2024Quote: The expression vectors encoding truncated AlkB and AlkB D135S (13) pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Neuroscience 2022Quote: ... The AU1-tagged wild-type and two mutant (S2215Y and R2505P) mTOR constructs were gifts from Fuyuhiko Tamanoi (Addgene) 59 ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Molecular Biology 2023Quote: All-in-one lentiviral plasmids for Dox-inducible expression of UNK without GFP in HeLa cells were created by insertion of the Flag-HA-tagged full-length WT or mutant UNK amplified from the corresponding entry vector into the pLIX_403 plasmid (Addgene_41395) between NheI and AgeI sites ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... MOLM-13/Cas9+ cell line stably expressing luciferase was established via lentiviral infection with a Lenti-luciferase-P2A-Neo (Addgene # 105621) vector followed by G418 (1 mg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... into the AC and a retrograde Cre virus: pENN/AAVrg-hSyn-Cre-WPRE-hGH (1.8E+13 vg/ml, 200nl, Addgene catalog #105553) into the pStr ...
-
bioRxiv - Neuroscience 2023Quote: ... We bilaterally injected Cre-dependent DREADD virus (Roth, 2016): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4E+13 vg/ml, 350nl, Addgene catalog # 44362) or AAV5-hSyn-DIO-mCherry (2.6E+13 vg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Neuroscience 2024Quote: ... Pulled injection pipettes were beveled and back-filled with mineral oil before being loaded with one or more of the following: AAV1-Syn-ChrimsonR-tdTomato (Chrimson, 2.10e+13 gc/mL, 250 nL, Addgene #59171-AAV1), AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after selection in 300 μg/ml G418 cells were tagged with luciferase by transduction with lentiviruses expressing pFU-Luc2-eGFP (Addgene).
-
bioRxiv - Cancer Biology 2022Quote: ... were purchased from Horizon Discovery while the lentiviral vectors expressing scrambled shRNA (Sarbassov et al., 2005) and flag-tagged DPYD (Shaul et al., 2014) were bought from Addgene Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484. Addgene) using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells expressing GFP alone or pLVX:GFP-CLIC4 were lysed and proteins were immunoprecipitated using a GST-tagged GFP-nanobody (Addgene #61838) that was covalently linked to Affigel 10/15 resin (BioRad) ...
-
bioRxiv - Microbiology 2019Quote: ... were chromosomally tagged with YFP using the mini-Tn7 system 41 (Plasmid pUC18T-mini-Tn7T-Gm-eyfp and pTNS1, Addgene plasmid # 65031 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Cell Biology 2022Quote: ... XPA-KO HaCaT cells stably expressing Flag-tagged XPA were generated by transfecting cells with pcDNA4-Flag-XPA (Addgene #22895) and then selecting single clones with geneticin ...
-
bioRxiv - Molecular Biology 2023Quote: Stimulated emission depletion microscopy was performed on U2OS cells transduced with lentivirus expressing Flag-tagged PREPL cDNA (pCIG3, Addgene #78264). Cells were seeded 3 days post-transduction on coverslips (thickness #1.5H ...
-
bioRxiv - Biochemistry 2023Quote: Dephosphorylated AurA (residues 122-403, TEV-cleavable, N-terminal His6-tagged, kanamycin-resistance) in pET28a and LPP (#79748) from Addgene were cotransformed in BL21(DE3 ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...