Labshake search
Citations for Addgene :
201 - 250 of 1404 citations for Recombinant Human ERBB2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Ub-R-EGFP under CUP1 promoter was cloned from the plasmid pYES2-Ub-R-EGFP (Addgene #11953) (29 ...
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Microbiology 2022Quote: To make human ACE2 protein, pcDNA3-sACE2-WT(732)-IgG1 (Chan et al., 2020) (Addgene plasmid #154104, gift of Erik Procko) plasmid was transfected into Expi293 cells using PEI at a ratio of 1:3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Biophysics 2022Quote: ... mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene, 54281), Golgi apparatus labeled by GalT-GFP (plasmid was a gift from the Patterson Lab ...
-
bioRxiv - Neuroscience 2019Quote: CAG-Mito-R-GECO: CMV-Mito-R-GECO1 (a gift from Robert Campbell; Addgene plasmid # 46021, RRID:Addgene_46021 (74)) was digested PmeI and the mito-R-Geco fragment was subcloned into EcoRV-digested pBSKII SK+ (Stratagene) ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Neuroscience 2022Quote: ... pTorPE-R-GECO1 (62) (Addgene Plasmid # 32465) was a gift from Robert Campbell (University of Alberta) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AAVS1 TALEN-R (Addgene plasmid #59026) 84 were used for targeting the UBrtTA ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid pCMV-R-GECO1 (Addgene Plasmid # 32444) was a gift from Robert E ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were co-transfected with plasmid encoding mCherry-tagged Parkin (31) (Addgene plasmid #23956;) and encoding either ABCB-ChR2-YFP or ABCB-YFP using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247). Cells were cultivated in Terrific broth (TB ...
-
bioRxiv - Cell Biology 2021Quote: ... the GST-tagged anti-GFP nanobody construct in pGEX-6P-1 vector (Addgene ID # 61838) was transformed to BL21 RIL (DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Genomics 2022Quote: ... and cloned into a lentivirus-based sgRNA vector tagged with GFP (Addgene plasmid no. 65656). Cas9-expressing T-ALL cell lines were transduced with sgRNA library virus at a low MOI (∼0.3) ...
-
bioRxiv - Microbiology 2024Quote: Triple FLAG-tagged Vpr and Vpx lentiviral expression vectors for HIV-2RODVpx (Addgene plasmid #115816), SIVSAB-92018Vpr (Addgene plasmid #115822) ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(chicken) is available from Addgene; #190692.
-
bioRxiv - Neuroscience 2023Quote: ... The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Biophysics 2022Quote: ... Cell endoplasmic reticulum (ER) was labeled by ERmoxGFP (Addgene, 68072), mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Plasmid RB-GFP FL for expression of GFP-tagged RB was obtained from Addgene (Catalog #16004). For ectopic gene expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng reference reporter (pcDNA3.1-Nanoluc-3xFLAG-V5) and 50 ng 3xFLAG tagged constructs (Addgene #87063). Transfection was carried out using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... iEC-ESCs and iHUF cells were tagged with Azurite blue using pLV-Azurite (Addgene plasmid 36086). Lentiviral transductions were performed according to manufacturers’ protocols and successfully tagged cells were further sorted on a Beckman Coulter MoFlow Astrios (Indianapolis ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for eGFP-tagged SpvB(Salmonella SpvB 375-591) sequence were obtained from Addgene (#89446) and cloned into the pMSCV-puro vector.
-
bioRxiv - Synthetic Biology 2021Quote: ... and pE-FLP (Addgene plasmid # 45978; http://n2t.net/addgene:45978 ; RRID:Addgene_45978) were gifts from Drew Endy & Keith Shearwin (Cui and Shearwin ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1.5 μg AAVS1 TALEN R (Addgene 59026) via the Neon Electroporation System (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432) targeting TTTCTGTCACCAATCCTG) ...
-
bioRxiv - Genetics 2023Quote: ... and 1.5 µg AAVS1 TALEN R (Addgene 59026) using Lipofectamine 3000 Transfection Reagent (Invitrogen L3000015 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Developmental Biology 2020Quote: ... gRNA oligos for WNT11 (F: CACCGGTCCTCGCTCCTGCGTGGGG; R: AAACCCCCACGCAGGAGCGAGGACC) and PAX2 (F: CACCGATGACCGCCACTAGTTACCG; R: AAACCGGTAACTAGTGGCGGTCATC) were synthesized and cloned into the lentiCRISPR v2 plasmid (Addgene # 52961). First ...
-
bioRxiv - Cell Biology 2021Quote: ... and cytosolic Ca2+ was monitored by the intensity of the sensor R-GECO (plasmid was a gift from R. Campbell, Addgene #45494). To decrease cytosolic Ca2+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...