Labshake search
Citations for Addgene :
651 - 700 of 1080 citations for Recombinant Human CRISP2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Two-cell-stage embryos were bilaterally injected with 400 pg human EEA1 tagged to GFP (GFP-EEA1 wt was a gift from Silvia Corvera; Addgene plasmid # 42307 ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Immunology 2023Quote: ... MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Human foreskin fibroblasts (HFF, SCRC- 1041, ATCC) were immortalized using a human telomerase-expressing retrovirus (pWZL-Blast- Flag-HA-hTERT, 22396, Addgene).
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Genetics 2023Quote: Two sgRNA oligonucleotide probes targeting different sites in human PIF1 and RAD52 or non-target were cloned into lentiCRISPRv2 puro (Addgene). Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara ...
-
bioRxiv - Immunology 2023Quote: ... PH5CH and Huh7-Lunet-TLR3 cells stably expressing the tBID death reporter and Cas9 were transduced with lentiviral vectors containing the GeCKOv2.0 human genome-wide sgRNA library (Addgene, USA) at MOI=0.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... The Scrib-Flag plasmid was generated by amplifying human Scrib coding sequence from MSCV Puro SCRIB WT (Addgene, Cat# 88886) and fused with 3xFlag tag at the C-terminal in pcDNA3 backbone ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid for expression of full-length human KIF1C (pKIF1C-GFP) was a gift from Anne Straube (Addgene plasmid #130977107). All truncated versions of KIF1C (see Resource Table) ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... For expression of the Cas9 protein the lentiCas9-Blast expression vector was used (Addgene plasmid #59262 ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Biophysics 2020Quote: The plasmid for membrane scaffold protein was MSP1D1 in pET28a was purchased from Addgene and prepared as previously described (Hagn et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Immunology 2020Quote: ... and VSV-G protein-encoding plasmid pMD2.G were obtained from Addgene (Watertown, MA).
-
bioRxiv - Developmental Biology 2019Quote: ... RNPs of Cas9 protein (Cas9-mCherry, pMJ293 (Burger et al., 2016) (available from Addgene)) and sgRNA were in vitro-assembled for 10 min at 37°C in 300 mM KCl to ensure maximum cleavage efficiency and microinjected into the cell of one-cell stage embryos (Burger et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.