Labshake search
Citations for Addgene :
201 - 250 of 1018 citations for Recombinant Human CDH8 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... pET29b-IPP1-His was a gift from Sebastian Maerkl & Takuya Ueda (Addgene plasmid # 124137). 15µL of Lemo21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Biochemistry 2023Quote: GST-HRAS and His/MBP-KRAS were purchased from Addgene (#55653 and # 159546, respectively). GST-KRAS was created with standard Gibson Assembly (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Plasmid RB-GFP FL for expression of GFP-tagged RB was obtained from Addgene (Catalog #16004). For ectopic gene expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng reference reporter (pcDNA3.1-Nanoluc-3xFLAG-V5) and 50 ng 3xFLAG tagged constructs (Addgene #87063). Transfection was carried out using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... iEC-ESCs and iHUF cells were tagged with Azurite blue using pLV-Azurite (Addgene plasmid 36086). Lentiviral transductions were performed according to manufacturers’ protocols and successfully tagged cells were further sorted on a Beckman Coulter MoFlow Astrios (Indianapolis ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for eGFP-tagged SpvB(Salmonella SpvB 375-591) sequence were obtained from Addgene (#89446) and cloned into the pMSCV-puro vector.
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HALO-tagged version of this plasmid was created by replacing eGFP with NGFR (Addgene plasmid 27489) using Gibson assembly (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al., 2013)) ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Genetics 2020Quote: ... FLAG-tagged PALB2 was a gift from Daniel Durocher (pDEST-FRT/T0-FLAG-PALB2, plasmid #71114, Addgene)30 ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531; http://n2t.net/addgene:69531; RRID:Addgene_69531)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069; http://n2t.net/addgene:80069; RRID:Addgene_80069), mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824; http://n2t.net/addgene:43824; RRID:Addgene_43824)23 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Immunology 2021Quote: ... Monomeric MBP-tagged NLRP3NACHT-LRR (aa 134-1034) was subcloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863) with addition of N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...