Labshake search
Citations for Addgene :
501 - 550 of 1080 citations for Recombinant Human CD93 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Biophysics 2022Quote: ... pET15b CnA CnB, which contains human PPP3CA and PPP3R1 (Mondragon et al., 1997) was obtained from Addgene (11787). Plasmid pQE30 CaM containing rat Calmodulin (protein sequence 100% identical to human ...
-
bioRxiv - Molecular Biology 2019Quote: ... Complemention of timeless was achieved by transfection of plasmids encoding the human Timeless WT cDNA (Addgene plasmid 22887), or truncated versions thereof ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055; http://n2t.net/addgene:36055 ; RRID:Addgene_36055).
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
bioRxiv - Molecular Biology 2019Quote: Full length wild type human DHX30 cDNA corresponding to transcript (ENST00000348968.8) was cloned into the TetON lentiviral vector pCW57.1 (Addgene), exploiting the Nhe I and Age I restriction endonucleases ...
-
Comparative performance of the BGI and Illumina sequencing technology for single-cell RNA-sequencingbioRxiv - Genomics 2019Quote: Comprised of cultured human trabecular meshwork cells (TMWCs) that had been transfected with a CROP-seq (Addgene: 99248) guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012; http://n2t.net/addgene:44012; RRID:Addgene_44012). All cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum and penicillin–streptomycin (1%) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.2 (a1Ha-pcDNA3 was a gift from Dr E. Perez-Reyes, Addgene #45809 (Cribbs et al. 1998), human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... The respective cell lines were subsequently transduced with the human genome-wide CRISPR-KO (GeCKO, Addgene, #1000000048, #1000000049) sgRNA library at a 1000-fold representation and a multiplicity of infection of <0.3 to ensure one sgRNA integration per cell ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of human CAV1 was PCR amplified from the mammalian expression plasmid Emerald-CAV1 C-10 (Addgene No ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Genetics 2020Quote: ... The expression plasmid for human Nucleolin was constructed by amplifying the NCL ORF from GFP-Nucleolin (Addgene; #28176) using primers NCL-For and NCL-1XHA Rev (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... human telomerase (hTERT) was exogenously expressed using pBABE-neo-hTERT (Addgene 1774, a gift from Bob Weinberg ((44)) ...
-
bioRxiv - Neuroscience 2022Quote: ... A135P and wildtype human iPSC-derived NGN2 neurons were transfected with 0.8 µg of Mito7-dsRed (Addgene #55838) and 0.2 µg of pCAG-Venus at day 5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... A2058-dCas9-KRAB cell lines were infected with Stress and Proteostasis-human subpooled sgRNA library (Cat#83973, Addgene), with MOI=0.3 and selected with puromycin (2 μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... expressing 76,441 sgRNAs against 19,114 human genes + 1,000 non-targeting sgRNA controls in plentiCRISPRv2 was obtained from Addgene (51). The library was electroporated into Endura electrocompetent cells (# 60242 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human NALCN cDNA and the mCherry cDNAs were subcloned in the pLV-EF1a-IRES-Blast (Addgene #85133) using standard molecular biology techniques.
-
bioRxiv - Molecular Biology 2023Quote: The genome-wide human CRISPR/Cas9 Synergistic Activation Mediator (SAM) sgRNA library (gift from Feng Zhang, Addgene #1000000057) was amplified as recommended ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cell Biology 2023Quote: The human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) (49) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ; http://n2t.net/addgene:103938; RRID:Addgene_103938). Plasmids encoding tethered fusion constructs were custom cloned by Epoch Biosciences (Missouri City ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074; http://n2t.net/addgene:24074; RRID:Addgene_24074). GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Immunology 2024Quote: ... U87 MG IL13Rα2+ RFP+ cells were generated by stable expression of human IL13Rα2 and RFP (Addgene plasmid #26001) and sorting for RFP and IL13Rα2 expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Biophysics 2021Quote: ... This vector also contains EF1α promoter for target protein expression (Addgene #65712) and puromycin resistance gene under PGK promoter for antibiotic selection of the transferred cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids coding for the following protein products were obtained from Addgene: non-fluorescent FRB-ECFP(W66A)-Giantin [# 67903 ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Biochemistry 2021Quote: ... The plasmid encoding for membrane scaffold protein MSP1D1 was purchased from AddGene.43
-
bioRxiv - Genomics 2020Quote: Tn5 was generated by the MDC Protein Production & Characterization Platform from Addgene plasmid #60240 according to76 at 1.95 mg/ml with the following minor modifications ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...