Labshake search
Citations for Addgene :
451 - 500 of 1275 citations for Recombinant Human CD33 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cell Biology 2019Quote: Human STAMBPL1 was PCR amplified from FLAG-HA-STAMBPL1 (Addgene plasmid #22559), human TBC1 domain containing kinase (TBCK ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABAergic projection neurons in the basal forebrain were retrogradely labeled using a unilateral injection of AAVrg-hSyn-DIO-eGFP in the OB (50 nL, Catalog #50457-AAVrg, Addgene), guided with a stereotaxic apparatus (Kopf ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines for use in orthotopic in vivo experiments were labeled with pLenti-PGK-V5-LUC Neo (Addgene plasmid #21471). The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455) ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2021Quote: ... Cre-dependent GCaMP6s plasmid labeled with nuclear dTomato (pAAV-EF1α-DIO-GCaMP6s-P2A-NLS-dTomato) was acquired from Addgene (plasmid #51082). Cre expression plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2019Quote: ... The H2B-mRFP expression construct for human cells was obtained from Addgene (#26001), transfected to 293T cells to produce viruses and infect HeLa Cyclin B1-Venus expressing cells to generate a stable cell line ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human CTNNB1 expression plasmid deposited by Eric Fearon was purchased from Addgene (#16828). CD24 cDNA cloned into the pCDNA3.1 vector and the full-length 3′-UTR of CD24 cloned into pMIR (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human MRTFA was amplified out of the p3xFLAG-MRTFA vector (Addgene plasmid#11978) and tagged with gateway adapters which preserve the N-terminal 3x FLAG tag from the vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...