Labshake search
Citations for Addgene :
201 - 250 of 378 citations for Recombinant Cynomolgus CD40 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531; http://n2t.net/addgene:69531; RRID:Addgene_69531)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069; http://n2t.net/addgene:80069; RRID:Addgene_80069), mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824; http://n2t.net/addgene:43824; RRID:Addgene_43824)23 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Immunology 2021Quote: ... Monomeric MBP-tagged NLRP3NACHT-LRR (aa 134-1034) was subcloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863) with addition of N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Biochemistry 2019Quote: ... a mammalian expression vector pRK5 encoding EGFP tagged wild-type (WT) human tau (pRK5-EGFP-tau, # 46904, RRID: Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal sequences (0N4R) ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Neuroscience 2022Quote: ... The AU1-tagged wild-type and two mutant (S2215Y and R2505P) mTOR constructs were gifts from Fuyuhiko Tamanoi (Addgene) 59 ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: All-in-one lentiviral plasmids for Dox-inducible expression of UNK without GFP in HeLa cells were created by insertion of the Flag-HA-tagged full-length WT or mutant UNK amplified from the corresponding entry vector into the pLIX_403 plasmid (Addgene_41395) between NheI and AgeI sites ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after selection in 300 μg/ml G418 cells were tagged with luciferase by transduction with lentiviruses expressing pFU-Luc2-eGFP (Addgene).
-
bioRxiv - Cancer Biology 2022Quote: ... were purchased from Horizon Discovery while the lentiviral vectors expressing scrambled shRNA (Sarbassov et al., 2005) and flag-tagged DPYD (Shaul et al., 2014) were bought from Addgene Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484. Addgene) using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells expressing GFP alone or pLVX:GFP-CLIC4 were lysed and proteins were immunoprecipitated using a GST-tagged GFP-nanobody (Addgene #61838) that was covalently linked to Affigel 10/15 resin (BioRad) ...
-
bioRxiv - Microbiology 2019Quote: ... were chromosomally tagged with YFP using the mini-Tn7 system 41 (Plasmid pUC18T-mini-Tn7T-Gm-eyfp and pTNS1, Addgene plasmid # 65031 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Cell Biology 2022Quote: ... XPA-KO HaCaT cells stably expressing Flag-tagged XPA were generated by transfecting cells with pcDNA4-Flag-XPA (Addgene #22895) and then selecting single clones with geneticin ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Stimulated emission depletion microscopy was performed on U2OS cells transduced with lentivirus expressing Flag-tagged PREPL cDNA (pCIG3, Addgene #78264). Cells were seeded 3 days post-transduction on coverslips (thickness #1.5H ...
-
bioRxiv - Biochemistry 2023Quote: Dephosphorylated AurA (residues 122-403, TEV-cleavable, N-terminal His6-tagged, kanamycin-resistance) in pET28a and LPP (#79748) from Addgene were cotransformed in BL21(DE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...