Labshake search
Citations for Addgene :
1 - 50 of 75 citations for Recombinant Autographa Californica Multiple Nucleopolyhedrovirus Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... a multiple cloning cassette in pGGEV_6 and pGGEV_7’ _linker (#49293 Addgene) into ...
-
bioRxiv - Biochemistry 2021Quote: ... Multiple sgRNAs were ligated to the linearized PX330 vector (Addgene, #42230). To evaluate the targeting efficiency of different sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... cloned into the multiple cloning site of the pMSCV-mCherry FP vector (Addgene, 52114), and sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... were synthesized from Genscript and inserted into the multiple cloning site of pLV-EF1a-IRES-Hygro (Addgene 85134). To construct rescue cell lines (shNTC+empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... multiple gene-specific gRNAs were combined and co-transfected with pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2020Quote: Multiple gRNAs per enhancer region were designed with CRISPR-SURF39 and cloned into lentiGUIDE-puro (Addgene #52963). All gRNA sequences are provided in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2022Quote: ... a multiple cloning site (MCS) was first generated in pAAV-CAG-hChR2-H134R-tdTomato (Addgene catalog #28017). The MCS was generated by annealing the following two primers 5’-gatccgctagcgtttaaacttaaggtaccgagctcactagtgaattctgcagatatccagcacagtggcggccgctcgagggcccttcg a-3’ and 3’-gcgatcgcaaatttgaattccatggctcgagtgatcacttaagacgtctataggtcgtgtcaccgccggcgagctccc gggaagcttcga-5’ ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2023Quote: ... we cloned ∼750 bp of the regions upstream and downstream of the sRNA into the multiple cloning site of pSIE1 (a gift from Andrew Goodman, Addgene plasmid #136355; http://n2t.net/addgene:136355; RRID:Addgene_136355). The plasmid was then conjugated into B ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then multiple gRNA cassettes were cloned into lentiviral expression vectors (pLV hUbC-Cas9-T2A-GFP; Addgene, #53190) using Golden Gate cloning technology ...
-
bioRxiv - Developmental Biology 2021Quote: ... ubi:eGFP was constructed by inserting a ubi:hKCNH2 and a ubi:eGFP cassette into the multiple cloning site of pminiTol2 (Addgene #31829).
-
bioRxiv - Synthetic Biology 2021Quote: ... multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus ...
-
bioRxiv - Cancer Biology 2022Quote: ... we subcloned the different Kat7 constructs in the multiple cloning site of the pMSCV-mCherry FP vector (Addgene, 52114). Finally ...
-
bioRxiv - Genetics 2021Quote: The pAAV-stop-MCS-bGH plasmid was created as follows: The multiple cloning site (MCS) and bGH-polyA sequence from the Donor_eGP2AP_RC plasmid (Addgene #133784) was cloned into the pAAV.CMV.PI.EGFP.WPRE (Addgene #105530 ...
-
bioRxiv - Molecular Biology 2021Quote: ... We followed the standard principles to avoid off-target effects when choosing between multiple gRNA targets for each PE and cloned into the modified U6.3>gRNA.f+e backbone (Addgene #99139) as described in 54 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a second multiple cloning site was introduced into pBbA5 (pBbA5c-RFP was a gift from Jay Keasling, Addgene plasmid #35281) (42 ...
-
bioRxiv - Genetics 2020Quote: ... targeting multiple LTR copies were cloned into lentiviral expression vector pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene 50946, deposited by K. Yusa). For LTR silencing ...
-
bioRxiv - Genetics 2020Quote: ... These plasmids were constructed through multiple rounds of cloning using DNA fragments from yeast DNA or plasmids acquired from Addgene (kind gifts from John McCusker ...
-
bioRxiv - Microbiology 2023Quote: ... we cloned ∼750 bp of the regions upstream and downstream of the sRNA into the multiple cloning site of pSIE1 (a gift from Andrew Goodman, Addgene plasmid #136355 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Cell Biology 2021Quote: ... To combine multiple GOI we also used the lentiviral vector EF1a-Hygro/Neo a gift from Tobias Meyer (Addgene plasmid # 85134). Briefly ...
-
bioRxiv - Developmental Biology 2023Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 100ng MSCV plasmid (MSCV multiple cloning site IRES puroR 2A mCherry or GFP) and 10ng pVSVg plasmid (Addgene 8454) with Lipofectamine 2000 (Thermo) ...
-
bioRxiv - Cell Biology 2022Quote: ... Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan; Addgene plasmid #85401) and delivered to iCas9-expressing THP-1 cells by the lentiviral system ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Microbiology 2024Quote: ... We first cloned the desired inserts (i.e., promoters and mNeonGreen fluorophore) into the multiple cloning site of a pJM220 mini-Tn7 plasmid (Addgene, cat. Number 110559). Fragments were assembled using Gibson assembly (58 ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which were used to insert the RpoN-EBP into the multiple cloning site of the miniTn7 suicide vector pJM220 (obtained from the Addgene plasmid repository, plasmid #110559) by restriction-ligation ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole cell lysates (200 µg) were incubated with GST-RAF-RBD (Addgene) bound to glutathione agarose beads at 4°C for 1 hour ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...