Labshake search
Citations for Addgene :
1 - 50 of 10000+ citations for Rat TUT1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: The AAV-Tet3-shRNA plasmid (Addgene plasmid # 85740) was used as a backbone to generate the AAV9-hU6-shRptor-EYFP construct ...
-
bioRxiv - Cancer Biology 2024Quote: ... scrambled shRNA control (Addgene plasmid #1864), or an empty backbone pLKO.1 control (Addgene plasmid #8453 ...
-
bioRxiv - Molecular Biology 2023Quote: ... We used the scramble shRNA plasmid (Addgene_1864) for the expression of non-targeting control shRNA (Figure S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the control scrambled shRNA (plasmid #1864, Addgene) was provided by Dr ...
-
bioRxiv - Cancer Biology 2021Quote: Control shRNA was acquired from Addgene (plasmid 1864), from D ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Cancer Biology 2020Quote: ... to 2μg pLKO.1 shRNA plasmid: 1500ng psPAX2 packaging plasmid (Addgene #12260): 500ng pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cancer Biology 2024Quote: The Tet-pLKO-puro lentivirus vector (plasmid#21915) and the control shRNA lentivirus vector (pLKO-Tet-On-shRNA-Control, plasmid#398398) were purchased from Addgene (Watertown, USA). The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The scrambled sequence shRNA plasmid was purchased from Addgene, plasmid #1864 ...
-
bioRxiv - Cancer Biology 2019Quote: The shRNA/pLOK.1 targeting rictor (plasmid #1853, Addgene) and the control scrambled shRNA (plasmid #1864 ...
-
bioRxiv - Immunology 2023Quote: ... A scramble shRNA-expressing pLKO.1 (Addgene Plasmid #1864) was used as control (shScr) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Systems Biology 2020Quote: ... Scrambled shRNA plasmid was a kind gift from David Sabatini (Addgene plasmid #1864). shRNA plasmid against human GEF-H1 was obtained from Sigma (clone ID ...
-
bioRxiv - Cancer Biology 2023Quote: The following plasmids were used for knockdown experiments Scramble shRNA plasmid # 1864 (Addgene); FASN shRNA1 plasmid # 82327(Addgene) ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA to human raptor (plasmid#1857) and rictor (plasmid#1853) were purchased from Addgene. The preparation of shRNA infected HEK293 cells have been described previously (28).
-
SHARPIN enhances ferroptosis in synovial sarcoma cells via NF-κB- and PRMT5-mediated PGC1α reductionbioRxiv - Cancer Biology 2023Quote: ... the shRNA plasmid and the second generation packaging plasmids ΔR8.2 and VSV-G (Addgene) were transfected into 293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1.25 µg shRNA plasmid along with equivalent amount of psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used pLKO-Tet-On-shRNA-Control plasmid (98398, Addgene). dCasRx-FTOWT-HA plasmid was received as a generous gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864) (Sarbassov et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Linear ZsGreen fragment was amplified from plasmid pLVX-shRNA-ZsGreen (Addgene) with primers ZsGreen E-F and ZsGreen B-R (Table S1) ...
-
bioRxiv - Biochemistry 2020Quote: ... shRNA oligonucleotide were cotransfected with the packaging plasmids psPAX (Addgene #12260) and pMD2.G (Addgene ...
-
bioRxiv - Physiology 2022Quote: ... and scrambled shRNA plasmid (SC: ID 1864) were obtained from Addgene. HEK293T cells in 10 cm dishes were transfected using 50 μL 0.1% polyethylenimine ...
-
bioRxiv - Physiology 2022Quote: ... and scrambled shRNA plasmid (SC: ID 1864) were obtained from Addgene. HEK293T cells in 10 cm dishes were transfected using 50 μL 0.1% polyethylenimine ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251 ...
-
bioRxiv - Microbiology 2021Quote: ... shRNAs were cloned into pLVTHM plasmid which was a gift from Didier Trono (Addgene plasmid # 12247). We replaced GFP from pLVTHM with mCherry for selection ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Lentiviral particles for CEBPB knockdown were generated by transfecting shRNA plasmids (TRCN0000007440 and TRCN0000007442) or scramble shRNA control (a gift from David Sabatini; Addgene_1864 [50]), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: ... 1205Lu cells stably expressing LBR shRNA (Dharmacon) and NT shRNA (Dharmacon) were generated using the second generation lentiviral packaging plasmid psPax2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Microbiology 2021Quote: Transduction retrovirus particles were collected from HEK293T cells following Lipofectamine 3000 transfection of expression plasmids (pLenti CMV TetR BLAST and plenti X1 shRNA plasmids) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: ... An shRNA construct with a scrambled sequence (Plasmid # 36311) was from Addgene. Expression vectors for mature SREBP1a (Plasmid # 26801) ...
-
bioRxiv - Molecular Biology 2023Quote: ... shRNA containing lentiviral constructs or a scrambled lentivrial construct (Addgene plasmid #162011) together with psPAX-2 (Addgene plasmid #12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... Knockdown studies utilized a non-targeting scramble control shRNA (Addgene; plasmid #46896), CDHR5 KD shRNA (TRC clone TRCN000054168 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral construct pLL5.0 E-cadherin shRNA/mE-cadherin-mCherry (Addgene plasmid #101282), pLL5.0-eGFP-CAAX (Addgene plasmid #187252 ...
-
bioRxiv - Cancer Biology 2023Quote: shRNAs were cloned into the Tet-pLKO-puro vector (Addgene plasmid #21915) (Wiederschain et al ...
-
bioRxiv - Genomics 2021Quote: ... shRNA-specific plasmid together with lentiviral packaging plasmids like VSVG (a gift from Bob Weinberg, Addgene #8454), and PAX2 ...
-
bioRxiv - Biochemistry 2022Quote: The control pLKO.1-LUC shRNA vector and the pLKO.1-FLCN lentiviral shRNA vector were obtained respectively from Addgene (Plasmid #30324) and the RNAi Consortium (TRCN0000237886) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Neuroscience 2022Quote: ... we used scrambled shRNA with the following sequence: CCTAAGGTTAAGTCGCCCTCG CTCGAGCGAGGGCGACTTAACCTTAGG (Addgene plasmid # 1864). To visualize transfected neurons in sLTP experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... or 12ug of the pLKO vector for shRNAs (plasmid #8453; Addgene, Teddington, UK). After 16 h of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Cancer Biology 2020Quote: ... The shRNA sequences were assembled into a pLKO.1 lentiviral backbone (Addgene plasmid #10878), containing a puromycin resistance marker to allow for the antibiotic selection of transduced cells ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...