Labshake search
Citations for Addgene :
101 - 150 of 2526 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Genomics 2022Quote: ... dCas9-KRAB domain (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro was a gift from Charles Gersbach (Addgene plasmid # 71236 ...
-
bioRxiv - Cell Biology 2022Quote: ... The RhoA biosensor uses the AnillinAHPH domain (Piekny and Glotzer, 2008) and was obtained from Addgene (plasmid # 68026). The EGFP-AnilinAHPH was sub-cloned into pHR lentiviral backbone using similar sites and strategy as mentioned above ...
-
bioRxiv - Cancer Biology 2022Quote: ... Control and SUZ12 sgRNA targeting the VEFS functional domain were cloned into pL-CRISPR.EFS.Blast (plasmid was generated by replacing tagRFP in Addgene Plasmid #57819 with blasticidin S deaminase antibiotic selection marker ...
-
bioRxiv - Genetics 2022Quote: ... We made the dCas9-TurboID construct by replacing the KRBA domain on Lenti-dCas9-KRAB-blast (Addgene, 89567) with TurboID sequence (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This receptor harbors a myc-tag on its extracellular domain that can be visualized by immunostaining (Addgene #79128). A second virion expresses both the mCherry reporter and BFP under control of the Tetracycline responsive element (TRE-3G ...
-
bioRxiv - Molecular Biology 2023Quote: ... co-transfected with the domain III/pURD construct and an integrase expression vector pgk-φC31/pCB92 (Addgene #18935) [50] ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ; http://n2t.net/addgene:103938; RRID:Addgene_103938). Plasmids encoding tethered fusion constructs were custom cloned by Epoch Biosciences (Missouri City ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Biochemistry 2020Quote: ... and substrate domain (i.e., WMEDYDYVHLQG, a peptide derived from p130cas)—from its parent plasmid (a Kras-Src FRET biosensor, Addgene), (ii ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the scFV domain and a superfolder (sf)GFP coding sequence were amplified from the PlatTET-gRNA2 plasmid (Addgene #82559) and fused in frame with the catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... pET-3d plasmid containing Chicken Capping Protein α1 and β1 subunits was a gift from John Cooper (Addgene plasmid #13451) The N-terminal domain of mouse CAP1 in pSUMOck4 was described earlier66.
-
bioRxiv - Evolutionary Biology 2020Quote: ... five nanoliters of a solution containing both sgRNAs at a concentration of 40 ng/μL and Cas9 protein (Addgene #47327) at a concentration of 250 ng/μL32 was injected into one-cell-stage medaka embryos ...
-
bioRxiv - Biochemistry 2022Quote: The pET28a plasmid vector containing DNA sequences encoding the PANK3 protein (residues pro12 to Asn368) was purchased from Addgene (25518) and transformed into both E ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µg of pX330 plasmid containing sgRNA for the target protein and 0.2 µg of pcDNA3-FKBP-eGFP-HOTag3 (Addgene, #106924) were co-transfected using Lipofectamine 2000 (Thermo Scientific ...
-
bioRxiv - Genetics 2021Quote: ... For the effector plasmids (pPB_TRE3G::ScFv-GFP-KRAB_EF1a::Neo and pPB_TRE3G::ScFv-GFP-3a3L_EF1a::Neo) the GCN4 specific scFv domain and the sfGFP gene were amplified from PlatTET-gRNA2 plasmid (Addgene #82559) and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498) ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715 ...
-
bioRxiv - Biochemistry 2020Quote: ... Rationale for the generation of NPC1L1 mutants is presented in pFastBac NPC1L1-WT-N-terminal domain plasmid was from AddGene. The pCMV-FLAG-His6-NPC1L1-MLD was cloned in the pFLAG-CMV-3 plasmid (Sigma) ...
-
bioRxiv - Pathology 2022Quote: ... which enabled the insertion of all other alternative effector domains including D3A (amplified open reading frame, ORF, from Addgene #66819), D3B (amplified ORF from Addgene #66820) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the p300 HAT core domain (p300 core) was PCR amplified from the pcDNA-dCas9-p300-Core vector (Addgene, Plasmid #61357) and cloned into MluI/BstXI digested pHR-TRE3G-KRAB-dCas9-P2A-mCherry backbone ...
-
bioRxiv - Cell Biology 2022Quote: ... Samd14 lacking both SAM and CPB domains (Samd14 ΔCPBΔSAM) were cloned into mammalian expression plasmid pMSCV-Puro-IRES-GFP (PIG) (Addgene #21654) using BglII and EcoRI restriction digest sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... and its RdRp domain (aa 91-610) were obtained using PCR on a SINV cDNA plasmid template (pSIN ReP5-GFP-GluR1 from Addgene). The PCR fragments were subcloned into the pSUMO-LIC vector using a ligation-independent cloning method in which the expressed recombinant protein had an N-terminal hexahistidine-linked small ubiquitin-like modifier protein (His6-SUMO ...
-
bioRxiv - Microbiology 2020Quote: The nucleic acid sequences of N-terminal adhesin domains of CfaE and class 5 adhesins (GenBank M55661) were cloned into a pMAL-C5X vector (Addgene) in-frame with an MBP tag to express as periplasmic proteins with improved solubility (MBP–CfaE-N) ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNAs of P4M (plasmid #51472) (Hammond et al., 2014) and PLCδ-PH domain (plasmid #21179) (Stauffer et al., 1998) were obtained from Addgene. The tRFP cDNA was a gift from Hideki Shibata (Nagoya University ...
-
bioRxiv - Genomics 2023Quote: ... the DNA sequence of KRAB repressor domain was amplified by PCR from the pHAGE TRE dCas9-KRAB (Addgene plasmid #50917) and cloned in frame into the PB-TRE-dCas9-VPR backbone (Addgene plasmid #63800 ...
-
bioRxiv - Biochemistry 2023Quote: ... The PH domain from GFP-C1-PLCdelta-PH was subcloned into pET His6 GST TEV LIC cloning vector (1G) (Addgene plasmid # 29655 which was a gift from Scott Gradia ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...