Labshake search
Citations for Addgene :
1 - 50 of 353 citations for Rat Small Nuclear Ribonucleoprotein U5 Subunit 200 SNRNP200 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Molecular Biology 2023Quote: ... under the control of the Metallothionein A promoter were generated using the previously described pMT FLAG MCS puro plasmid.26 The reporter plasmid expressing eGFP downstream of the U4:39B snRNA gene was previously described.41 An analogous reporter expressing eGFP downstream of U5:34A snRNA (Hy_U5:34A eGFP SV40, Addgene #195064) was generated from Hy_pPepck1 eGFP SV40 ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biophysics 2024Quote: ... and γ subunits were gifts from Christie Thomas (Addgene plasmid # 83430 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding heteronu-clear ribonucleoprotein A1 (hnRNPA1) was amplified from pET9d-hnRNP-A1 (#23026, Addgene) using PCR and inserted into mCherry-C1 (pmCherry-hnRNPA1) ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear-localized mCherry was digested from pBRY-nuclear mCherry-IRES-PURO (Addgene plasmid 52409) and the ~860bp band was gel purified ...
-
bioRxiv - Cancer Biology 2024Quote: ... or small splice variant TNC (Addgene 65415) and WPMY cells were overexpressed with Wnt-2 (Addgene 43809) ...
-
bioRxiv - Bioengineering 2024Quote: ... H2B-iRFP nuclear marker was (Addgene Plasmid #90237). ELP48 was obtained from Addgene (Addgene Plasmid #68395) ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the epsilon subunit of the bacterial FoF1-ATP synthase cDNA (Addgene plasmid #113906) was inserted into mTQ2-pRSET-A plasmid at Tyr-145 (between the KpnI and EcoRI restriction sites ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Biochemistry 2024Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene #53755-53762). Each was subcloned into FlexiBAC SF9 expression plasmids61 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The SV40 nuclear localization sequence (CACTTTCCGCTTTTTCTTTGG, Addgene plasmid #39319) was cloned downstream the tagBFP combining inverse PCR and blunt end ligation (T4 Ligase NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... which encodes nuclear GFP and membrane TdTomato (Addgene, plasmid #26771). For the rescue experiment ...
-
bioRxiv - Microbiology 2020Quote: ACE2 small guide RNA was constructed into pSLQ1651 (Addgene #51024) (44 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 6ug nuclear-localized GFP construct (Addgene #67652) using Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLenti-CMV/TO-SV40 small + Large T (w612-1) (#22298, Addgene), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Biophysics 2024Quote: Nuclear-targeting Csm complex plasmid construction has been described previously12 (Addgene plasmid #195242). Cytoplasmic-targeting Csm complex plasmid was modified from this by removing the NLS sequences before each protein sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Neuroscience 2020Quote: ... receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168; http://n2t.net/addgene:49168; RRID: Addgene_49168). Rat GABAAα1 (NM_183326 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Immunology 2024Quote: ... MEFs were transfected with SV40 small+large T antigen-expressing plasmid (22298, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Physiology 2024Quote: ... naked mole-rat and Cape mole-rat fibroblasts were transduced with lentivirus pLYS1-FLAG-MitoGFP-HA (Addgene plasmid #50057 ...
-
bioRxiv - Neuroscience 2023Quote: ... A small cohort of mice also received pAAV9-hSyn-DIO-hM4D(Gi)-mCherry (RRID:Addgene_44362 ...
-
bioRxiv - Plant Biology 2021Quote: ... IPT3 promoter was cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), tdTOMATO CDS ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928, http://n2t.net/addgene:17928; RRID:Addgene_17928; (Luo et al., 2002)) ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925; http://n2t.net/addgene:17925; RRID:Addgene_17925; (Luo et al., 2002)) ...
-
bioRxiv - Microbiology 2023Quote: The eSpCas9(1.1) gene containing two nuclear localization signals (NLS) was obtained from Addgene (Plasmid #71814) and cloned into the pST32 vector ...
-
bioRxiv - Genetics 2021Quote: ... is intended for small-medium sized donor DNAs (<15kb) while the p5155 (Addgene reference 175391) is a low-copy version for use with larger donor DNAs (>15kb) ...