Labshake search
Citations for Addgene :
251 - 300 of 2513 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 µl of pre-diluted AAV8-p4BDNF-ERT2CreERT2 was mixed with 5 µl of AAV8-CAG-FLEX-tdTomato (Addgene) and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Neuroscience 2022Quote: ... anesthetized GAD1:Cre rats and wildtype littermates were injected with one of three AAV2 viral constructs obtained from Addgene: hSyn-DIO-hM4D(Gi)-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats received bilateral HPCv injection (300nL/side) of a Cre-dependent hM4Di-expressing virus (AAV2-Flex-hM4Di-mCherry; Addgene) using the same stereotaxic coordinates as the TRAP approach ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Cancer Biology 2024Quote: DIV06 rat cortical neurons were infected with AAV5 virus based on the AAV-Flex-TACasp3-TEVP plasmid (Addgene #45580)83 at a titer of >7x108 vg/ml ...
-
bioRxiv - Immunology 2021Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vectors 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) or 2C-T (AmpR ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Synthetic Biology 2022Quote: The plasmids for Dox-inducible expression of the ddGFP PAR-T constructs were generated using a cDNA for ddGFP-A (Addgene, 40286) or ddGFP-B (Addgene ...
-
bioRxiv - Biophysics 2022Quote: For biolayer interferometry experiments protease 2A from CV-B3 was sub-cloned into LIC cloning vector 2Bc-T (Addgene plasmid # 37236) with a C-terminal His6-tag ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Plant Biology 2020Quote: ... FolSIX418-242 and FolSIX617-225) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The delCTCF(CS38) and inv(T-DOM) alleles were generated after cloning the gRNAs into the pX330:hSpCas9 (Addgene ID 42230) vector and DNA injection into pronuclei ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... N3 (residues 365-419) was similarly inserted into UC Berkeley Macrolab vector 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Biochemistry 2023Quote: ... The PrcA and PrcB genes were sub-cloned in the pET His6 TEV LIC cloning vector (2B-T, a generous gift from the Scott Gardia lab) (Addgene# 29666) and pET His6 TEV LIC cloning vector (2A-T ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...