Labshake search
Citations for Addgene :
201 - 250 of 2587 citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... the OCP-pET28 plasmid was co-expressed with pAC-CANTHipi plasmid (gift from Francis X Cunningham Jr, Addgene plasmid # 53301 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The linear transcript used as a negative control consists of GFP expressed from pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid 12252).
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2021Quote: Expression cassette comprising of genes encoding PEPCK along with 1 kb of its promoter was cloned into pIB3 vector (cat # 25452, Addgene, USA) and expressed in P ...
-
bioRxiv - Molecular Biology 2019Quote: The gene encoding full length Francisella novicida (Fn) Cas9 nuclease residues 1-1629 bp) was PCR amplified using PX408 (Addgene 68705) as a template and cloned in pET28-His-10-Smt3 vector (a kind gift from Prof ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA clones harboring a blasticidin-resistance gene were generated by cloning validated oligonucleotides into the EcoRI/AgeI sites of pLKO.1-Blast (Addgene, #26655). Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2022Quote: ... AAV plasmids carrying either cDNA for respective genes downstream of a CMV promoter were co-transfected with pAAV2/1 (Addgene #112862) encoding the AAV genes rep and cap ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sgRNA pair targeting the IKZF3 gene locus was designed using E-CRISP website (http://www.e-crisp.org/E-CRISP/) and expressed from pGL3-U6 sgRNA-PGK-Puro vector (Addgene 51133).
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Microbiology 2021Quote: ... Switzerland) and mStrawberry were stably expressed in hBMECs under Tetracycline inducible promoter in pLKO-Puro-tet plasmid (Addgene, 21915). All transfections were performed using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... pyogenes Cas9 (SpCas9) were expressed in Escherichia coli strain BL21 (DE3) using the expression plasmid pMJ806 (Addgene plasmid # 39312) (Jinek et al. ...
-
bioRxiv - Biophysics 2020Quote: ... We have also deposited BbZIP gene in pETNb-cALFA and hP2X3 gene in pBMNb-cALFA as positive controls for FSEC-Nb (Addgene IDs 160498 and 160499).
-
bioRxiv - Synthetic Biology 2021Quote: The Bxb1 gene was cloned from a plasmid (Addgene #123132) and inserted into the expression vector pET22 ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Biochemistry 2022Quote: ... The ShTnsC gene was inserted into the 1S (Addgene 29659) plasmid to produce a construct carrying a N-terminal hexahistidine and hexahistidine-SUMO tag followed by a TEV cleavage site and the ShTniQ was cloned into the 1C (Addgene 29659 ...
-
bioRxiv - Biochemistry 2022Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Microbiology 2021Quote: ... Sulf or Bar gene cassette in the pFGL821 (Addgene, 58223), pFGL820 (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... the sybody encoding gene in the pSBinit vector (Addgene #110100) was transformed into E ...
-
bioRxiv - Biophysics 2019Quote: The human Sox2 and Oct4 genes were purchased from Addgene and the human c-Myc and Max genes were amplified from HeLa cell cDNA (US Biological T5595-0449) ...
-
bioRxiv - Developmental Biology 2019Quote: ... NLRP7 and GFP genes were subcloned into pLEX307 (Addgene 41392) lentiviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShTnsC gene was inserted into the 1S (Addgene 29659) plasmid to produce a construct carrying a N-terminal hexahistidine and hexahistidine-SUMO tag followed by a TEV cleavage site and the ShTniQ was cloned into a 1C vector ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pCMVR8.74 expressing the gag/pol genes (Addgene plasmid 22036). The supernatants containing the viral particles were collected 48–72 h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... The EcSduA gene was inserted into the 1B (Addgene: 29653) plasmid using ligation-independent cloning (LIC) ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... we first replaced the eGFP gene in PX552 (Addgene # 60958) with tdTomato ...
-
bioRxiv - Microbiology 2023Quote: ... EGFP-p97 gene was amplified from pEGFP-p97 (Addgene #85670) and cloned into pMRX vector (Gifted by T Yoshimori ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids containing gene sequences for EphA4 (pDONR223-EPHA4, Addgene, 23919) and EphB3 (FUW-ubiquitin-EphB3-SV40-GFP ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid encoding the aeBlue gene was ordered from Addgene (#117846). The aeBlue chromoprotein gene was amplified in a PCR reaction using a KAPA Hi-Fi kit ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Biophysics 2019Quote: Genetic constructs encoding the inward rectifying potassium channel Kir2.1 and the blue-shifted channelrhodopsin CheRiff were separately cloned into lentiviral expression backbones (FCK-CMV) and then co-expressed in HEK 293T cells along with the lentiviral packaging plasmid PsPAX2 (Addgene) and the envelope plasmid VsVg (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Microbiology 2021Quote: The SpCas9 and guide RNA (gRNA) CRISPR components were both expressed from the one-vector lentiviral system “lentiCRISPR_v2” {25075903} (Addgene #52961). gRNA sequences for target genes were designed by submitting the sequence of an early exon (common to all isoforms ...
-
bioRxiv - Neuroscience 2023Quote: ... Projection mapping was performed with the membrane bound GFP expressed from AAV8-hSyn-JAWS-KGC-GFP-ER2 (Addgene 65014-AAV8). Calcium imaging experiments were performed with AAV1-Syn-FLEX-jGCaMP7f (Addgene 104492-AAV1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNAs targeting the SLIT2 gene were cloned into the lentiCRISPRv2 (Addgene) and the 20 bp sgRNA sequences used were CGGGTTGGTCTGTACACTCA for KO 1 and ACGGAAAGCTTTCCTTGGGA for KO 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... The human coding sequence for MYH10 gene was derived from Addgene plasmid ID# 11348 (Wei & Adelstein ...
-
bioRxiv - Genetics 2021Quote: ... This gene was assembled into VSV-eGFP-dG (Addgene, Plasmid #31842) in frame with the G coding sequence between MluI and NotI to generate VSV-eGPF-RABV-G ...
-
bioRxiv - Biochemistry 2021Quote: ... Amplified gene drmB was cloned in plasmid 13S-S (Addgene: 48329), resulting in a N-terminal 6X His tagged to the protein product ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against target genes were cloned in pLXsgRNA vector (Addgene# 50662) and lentiviral particles for sgRNA were produced in HEK293T cells by co-transfecting pLXsgRNA plasmid with pMD2.G (Addgene# 12259 ...
-
bioRxiv - Biochemistry 2021Quote: The full-length FOXO4 and p53 genes were acquired from Addgene. FOXO4 FHD (95-195 ...
-
bioRxiv - Genetics 2020Quote: ... which contains four unique sgRNA per gene in pXPR_050 (Addgene 96925) and was designed according to the same general principles as the ‘Brunello’ human genome-wide library (74 ...
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249). The pRPC-sponge plasmid is based on pLPT41 [8] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Microbiology 2020Quote: ... and sacB genes was excised from pGOAL19 (Addgene plasmid #20190; (46)) and cloned at PacI sites of p3875K and p4185K to generate the suicide vectors p3875K19 and p4185K19 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ampicillin resistance gene from the mTagBFP2-pBAD plasmid (Addgene #54572) with the GFPmut3 gene from pBTK503 (28 ...