Labshake search
Citations for Addgene :
1 - 50 of 229 citations for Rat Fibroblast Growth Factor 21 FGF21 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
bioRxiv - Cell Biology 2019Quote: ... or mRuby2 (Addgene #54768, (21), gifts from Michael Davidson ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 21 were obtained from Addgene (Addgene plasmid #80659 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used for KmR template[21] and pKDsgRNA-trmI (Addgene plasmid # 89955 ...
-
bioRxiv - Bioengineering 2019Quote: ... or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497). The Fubi-CHR2-GFP is a plasmid that generates channel-rhodopsin2 which is sensitive to blue light and C1V1tt plasmid generates a red-shifted channel-rhodopsin that is sensitive to green light [24] ...
-
bioRxiv - Cancer Biology 2023Quote: PB-TRE3G-MYCN and XLone-GFP (21) were acquired from Addgene. Plasmid information is provided in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2019Quote: ... pON.mCherry (21) which was a gift from Howard Shuman (Addgene plasmid # 84821), strain TP997 (40 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pcDNA3.1::miniSOG2-T2A-H2B-EGFP 21 were purchased from Addgene (USA). pSP-CiVACHT::Kaede was purchased from Ciona intestinalis Transgenic line RESources (CITRES) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The IRES site was amplified by PCR from pInducer-21 (Addgene #46948). YAP5SA was amplified by PCR from Addgene #33093 ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP reporter pTk-GFP-21 was constructed from pEF-GFP (Addgene #11154). The EF1a promoter was replaced by a SalI/ KpnI pTk promoter fragment ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal fibroblasts were immortalized with a pBABE-hydro-hTERT lentivirus (Addgene, #1773).
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Bioengineering 2020Quote: ... pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormon poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Developmental Biology 2024Quote: ... bovine growth hormone poly(A) signal (Addgene #132775) cloned into pUC18 vector (Addgene plasmid #50004 ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid expressing eSpCas9(1.1)21 was a gift from Feng Zhang (Addgene plasmid #71814). The U6 promoter was replaced with a tRNA promoter22 to facilitate the expression of sgRNA guides ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Cancer Biology 2021Quote: ... NIH 3T3 fibroblasts were transduced with either Life-Act eGFP (#84383, Addgene, Watertown, MA) or FUW-mCherry-E2A-rluc ...
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 amplified from cDNA obtained from 293T cells and the pINDUCER-21-RUNX1 plasmid (Addgene plasmid #97043 ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... 150,000 patient-derived fibroblasts were transfected with 900 ng of PE2-encoding plasmid (Addgene #132775), 300 ng of pegRNA-encoding plasmid ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... 150,000 patient-derived fibroblasts were transfected with 900 ng of ABEmax-encoding plasmid (Addgene, #112095). For prime editing ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector or eGFP-HSP70 (Addgene, Cat#15215) plasmid using an Amaxa human dermal fibroblast kit and manufacturer recommended U2OS protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used for KmR template[21] and pKDsgRNA-trmI (Addgene plasmid # 89955; http://n2t.net/addgene:89955; RRID:Addgene_89955) was used for the lambda red recombinase system[25] ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Neonatal human dermal fibroblasts (HDFns) were transduced with lentiviruses containing pCHAC-mt-mKeima (Addgene plasmid #72342) (Lazarou et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Bioengineering 2020Quote: ... pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677; http://n2t.net/addgene:86677; RRID:Addgene_86677). cDNA for human TMPRSS2 and Hygromycin resistance gene was obtained by synthesis (IDT) ...
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Microbiology 2019Quote: ... 1.5 million fibroblast cells were transfected with the homologous recombination donor plasmid and an helper plasmid (Addgene #64221) (21) ...
-
bioRxiv - Neuroscience 2023Quote: ... a somatic targeting GtACR (AAV5-hSyn1-SIO-stGtACR1-FusionRed) 21 or ChR (AAV5-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA) were used (both Addgene). For long-term silencing a cre dependent TelC AAV (AAV5-hSyn-FLEX-TeLC-P2A-dTomato ...
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the Egr1 transcription factor (pcDNA3-Egr1, a gift from Eileen Adamson, Addgene plasmid #11729) known to stimulate the Cav3.2 promotor 25.
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells seeded to 150mm dishes were transfected with 21 μg of the human gRNA pooled library in lentiGuide-Puro (Addgene #1000000049), 15.75 μg of pSPAX2 and 5.25 μg of pVSV-G plasmids ...