Labshake search
Citations for Addgene :
151 - 200 of 2503 citations for Rat EGF Latrophilin And Seven Transmembrane Domain Containing Protein 1 ELTD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Microbiology 2022Quote: The SARS CoV-2 papain-like protease (PLpro) domain of Nsp3 was cloned from a doxycycline-inducible piggyBac transposon vector (PB-TAC-ERP2, Addgene# 80478) containing the synthesized full-length Nsp3 from the Wuhan-Hu-1 SARS CoV 2 strain (Alvarez and Yao ...
-
bioRxiv - Cell Biology 2023Quote: ... The oDi sequence encoding a coiled-coil dimerization domain was amplified by PCR (#503/#504) from SpyCatcher002-oDi (a gift from Mark Howarth, Addgene # 124661) (Khairil Anuar et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the oTet sequence encoding a tetramerization coiled-coil domain was obtained by PCR (#505/#506) from SpyCatcher002-oTet (a gift from Mark Howarth, Addgene # 124663) (Khairil Anuar et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Physiology 2023Quote: ... containing endothelial specific-promoter (CDH5, VE-Cadherin) and green fluorescent protein (GFP) and the plasmid pC4-RhE-FRB-Fis1 (Addgene Cat# 68056) containing human Fis1 gene were purchased from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715, Addgene, Watertown, USA) to Err2.
-
bioRxiv - Genomics 2021Quote: Human codon-optimized optimized Streptococcus pyogenes dCas9 with two C-terminal SV40 NLSs was fused at the N-terminus to the ABI domain (gift from Jerry Crabtree, Addgene plasmid #38247) and tagBFP ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Molecular Biology 2022Quote: ... the ACE2 and its ECT/PD domains were cloned into pBiFC-VN155 (I152L) and pBiFC-VC155 vector(Kodama and Hu, 2010) (Addgene, MA, USA). The RBD ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AcrIIC3-LOV2 hybrid constructs were created by inserting the LOV2 domain into our published CMV-driven AcrIIC3 expression vector (Addgene plasmid #120301) (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... The KT binding domain sequence of 53BP1 (aa 1235-1616) was PCR-amplified from pcDNA5-FRT/TO-eGFP-53BP1 (Addgene plasmid #60813) and cloned into pB66 downstream to the Gal4 DNA-binding domain ...
-
bioRxiv - Developmental Biology 2023Quote: ... Full-length Sema6a cDNA or shortened Sema6a lacking the sequence coding for the intracellular domain (bp 2680-3766) were cloned into the pCAG-GFP vector (Addgene, Cat #11150) to obtain pCAG-promotor-driven expression of Sema6a and Sema6aΔcyt with a GFP signal sequence located upstream.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534; http://n2t.net/addgene:69534; RRID:Addgene_69534, a gift from Timo Otonkoski). The SMASh degron domain was amplified from pCS6-SMASh-YFP ...
-
bioRxiv - Plant Biology 2022Quote: ... while the full-length coding sequence of HlMYB7 was cloned into the prey vector pGADT7-GW [DNA-binding domain (BD)] (Addgene Inc, MA, USA) using the In-Fusion Snap Assembly Kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus (0.25-1 μl) containing either AAV5: hSyn-DIO-hM3Dq-mCherry (excitatory DREADD; Addgene, Watertown MA), AAV5 ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids containing sgRNAs (Addgene 41824) and a human codon-optimized Cas9 (Addgene 41815 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids containing EYA2 (Addgene #49264), RUNX1T1 (Addgene #49264) ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-mCherry (Addgene) at a titer of 1.4-2.8×1013 GC/mL.
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA sequences containing the following target sequences were cloned into the pLKO.1-TRC cloning vector (Addgene, 10878): nontargeting (NT) ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Immunology 2023Quote: ... coli containing the pMF230 plasmid containing a constitutively active promoter and eGFP were ordered from Addgene and cultivated on 100 uM ampicillin LB agar plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... and MiniP containing pEMS1172 (Addgene, #29301), pEMS1375 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: - 22.1ug sgRNA containing pXPR_053 (Addgene 113591).
-
bioRxiv - Molecular Biology 2021Quote: Lentivirus containing dCas9-TET1 (#84475, Addgene) or dCas9-dTET1 (#84479 ...
-
bioRxiv - Microbiology 2023Quote: ... Electrocompetent cells containing pREDCas9 (Addgene #71541) were generated as previously described[68] ...
-
bioRxiv - Genomics 2023Quote: ... containing either miRFP670 (Addgene plasmid #163748) or tagBFP (Addgene plasmid #163747 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats in control groups received either rAAV5/hSyn-DIO-mCherry (Addgene #50459, 0.75μl), saline (1.2μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... DIV6 rat cortical neurons were treated with AAV-mDlx-NLS-mRuby (Addgene #99130) at a titer of >1x109 vg/ml.121 AAV-mDlx-NLS-mRuby2 was a gift from Viviana Gradinaru (Addgene plasmid #99130 ...