Labshake search
Citations for Addgene :
51 - 100 of 10000+ citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ShRNA RHS3979-9602214 was also cloned into the Tet-pLKO-puro (Addgene plasmid #21915). Lentiviral constructs were packaged in HEK293 cells transfected using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... or pLKO.1-Neo-CMV-tGFP-Scramble shRNA plasmid (Addgene#136035 as scramble control). Lentiviral vectors were packaged using packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene Plasmid #17920).
-
bioRxiv - Neuroscience 2020Quote: ... or shRNA constructs in combination with the psPAX2 packaging and pCMV-VSV-G envelope plasmids (Addgene plasmid #12260 and #8454) using FuGene HD (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: sgRNA and shRNA oligonucleotides (Table S1) were cloned into lentiCRISPR v2 (Addgene plasmid no. #52961) and into pSMP vector (Addgene plasmid no ...
-
bioRxiv - Immunology 2021Quote: ... Transfer plasmid (shRNA targeting ITGB1, Tln1 or Luc) was co-transfected with psPAX2 (12260, Addgene) packaging vector and pCMV-VSVg (8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ShRNAs against Cx31 and GFP control were constructed using Tet-pLKO-Puro (Addgene plasmid #21915). shRNAs used were as follows:
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... The shRNA plasmids were constructed based on the lentiviral backbone PLKO.1 (Addgene Cat# 8453) following the protocol provided by Addgene (https://www.addgene.org/protocols/) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Genetics 2021Quote: ... we used site-directed mutagenesis of a GFP expression plasmid (MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP plasmid, Addgene # 73576), and substituted a single G for a C to introduce an in frame stop codon (TAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scrambled shRNA (Addgene) was used as shControl ...
-
bioRxiv - Neuroscience 2020Quote: ... TSC2 shRNA (Addgene) and CAG-GFP plasmids were electroporated at 1ug/ul using a BTX electroporator set at 5V for 5 milliseconds for 3 pulses ...
-
bioRxiv - Neuroscience 2020Quote: ... a transfer plasmid containing rat Synapsin promoter and cDNA encoding GCaMP6s (Addgene plasmid #40753) was assembled and transfected with helper-free DJ plasmids (Cell Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: Control shRNA and shRNA against PTEN were purchased from Addgene (86645), Scramble siRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... shRNA targeting the C/EBPα and ELF1 were cloned into pLKO.1 vector (Addgene, plasmid # 26655) harboring a blasticidin-selectable marker ...
-
bioRxiv - Genomics 2020Quote: ... shRNA expression vectors were co-transfected with the pCMV- R8.74 and pMD2.G expression plasmids (Addgene #22036 and #12259 ...
-
bioRxiv - Neuroscience 2020Quote: ... Raptor_1 shRNA was a gift from David Sabatini (Addgene plasmid # 1857; http://n2t.net/addgene:1857; RRID:Addgene_1857). pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: shRNA sequences were inserted into pLKO cloning vector (a gift from David Root; Addgene plasmid #10878). shRNA lentiviral particles were generated by transfection of HEK293T with the pLKO vectors containing shRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T were co-transfected with lentiviral shRNA constructs and the packaging plasmids psPAX2 (Addgene; Cat# 12260) and MD2.G (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864 ; http://n2t.net/addgene:1864 ; RRID:Addgene_1864)78 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Neuroscience 2019Quote: ... Lentivirus was packaged via co-transfection of each pGIPZ-shRNA with pCMV-VSV-G (Addgene plasmid #8454)[29] and pCMV-dR8.2 (Addgene plasmid #8455)[29] into HEK 293T cells using Lipofectamine 3000 reagent (Life Technologies ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... As for the knockdown constructs, the ESRP1-shRNA plasmid (Horizon, V3THS_335722) was packaged by pPAX2 (Addgene # 12260) and pMD2.G (Addgene # 12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Doxycycline-inducible shRNAs were established using retroviral TRMPVIR vector (kind gift from Scott Lowe, Addgene plasmid #27994) as previously described54 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pMKO shRNA Bim was a gift from Joan Brugge (Addgene plasmid # 17235; http://n2t.net/addgene:17235; RRID:Addgene_17235)34 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNAs were designed and synthesized from IDT and cloned into Tet-pLKO-puro vector (Addgene plasmid # 21915) according to the previously used protocols 38 ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids to overexpress tRNAIle or with shRNAs targeting tRNAIleGAU were cloned into the plko.1 puromycin (Addgene # 8453) or blasticidin (Addgene #26655 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Sigma and lentiviral partilces were generated in HEK293T cells by contransfecting shRNA plasmid construct with pMD2.G (Addgene#12259) and psPAX2 (Addgene#12260) ...
-
bioRxiv - Physiology 2019Quote: ... envelope vector pMD2.G (ID #12259) and scrambled shRNA plasmid (sc: ID1864) were obtained from Addgene (Cambridge, MA). HEK293T cells in 10 cm dishes were transfected using 50µL 0.1% Polyethylenimine ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a control shRNA (a gift from David Sabatini; Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID: Addgene_1864) (52 ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371; http://n2t.net/addgene:185371; RRID:Addgene_185371), MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Doxycycline-inducible shRNAs targeting Renilla and Vat1 were generated in LT3GEPIR61 (gift from Johannes Zuber, Addgene plasmid # 111177). The 97-mer shRNA sequences were ordered from IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... β-catenin shRNA was purchased from Addgene (pLKO.1 puro shRNA β-catenin #18803). Scramble siRNA and p68 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Cancer Biology 2019Quote: ... CTNNB1 shRNA constructs (Addgene # 18803) were provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... AAV-shRNA-ctrl (Addgene, #85741), and pcDNA6/V5-HisA plasmid was modified ...
-
bioRxiv - Developmental Biology 2019Quote: ... a scramble shRNA (Addgene-1864) targeting a random sequence 5’-CCTAAGGTTAAGTCGCCCTCGC-3’ was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-GFP control (Addgene, #30323).
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO scrambled shRNA (Addgene (#1864)) was used as control.
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Cell Biology 2020Quote: ... pBrain-GFP-shTACC3 shRNA was a gift from Stephen Royle (Addgene plasmid # 59355; http://n2t.net/addgene:59355; RRID: Addgene_59355), pBrain-GFP-shGL2 was a gift from Stephen Royle (Addgene plasmid # 60004 ...
-
bioRxiv - Cancer Biology 2021Quote: ... each shRNA sequence was inserted into the Tet- pLKO-puro vector (a gift from Dmitri Wiederschain; Addgene plasmid #21915). The most efficient shRNA sequences we used were TRCN0000281204 for G6PDsh ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lentiviral control vector containing a scrambled shRNA (shSCR) was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...