Labshake search
Citations for Addgene :
301 - 350 of 927 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... CryC was constructed by inserting PCR amplified spTC (Addgene plasmid #153003, (Cho et al., 2020a)) onto restriction-digested Cry2-mCherry (Addgene plasmid # 26871 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_eGFP was generated by PCR amplifying the eGFP CDS from Arch(D95H)-eGFP (Addgene #51081) and inserting into pcDNA3.1(-)/myc-His A using the EcoRI and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1-GPR91 was generated by PCR amplifying the GPR91 CDS from SUCNR1-Tango (Addgene #66507) (introducing a stop codon ...
-
bioRxiv - Biophysics 2023Quote: ... The baculovirus transfer vector pFastBac HT was PCR-amplified from pFastBac HT JS-Munc18b (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Cas13d-NLS cassette was PCR-amplified from the pXR001_EF1a-CasRx-2A-EGFP (Addgene #109049) plasmid and cloned into pLX_TRC311-NLS-Cas13b-NES-P2A-Blast-eGFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA fragment encoding APEX2 was PCR amplified from pcDNA5/FRT/TO APEX2-GFP (Addgene) and fused to the N-terminus of DDX3X using fusion PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... mEGFP was amplified using PCR and cloned into pLgw V5-EcoDam lentiviral constructs (Addgene; 59210) using SLIC ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were cloned into the doxycycline-inducible plasmid pCW57-MCS1-2A-MCS2 (Addgene #71782), which was modified by adding bGHpolyA between the MluI and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... the M13-encoding sequence was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated between the ER-membrane targeting sequence and the NFAST-encoding sequence in the above described ER-NFAST plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215) along with a T2A-NLS-mApple minigene for fluorescent visualization ...
-
bioRxiv - Systems Biology 2024Quote: ... coli origin of replication and ampicillin resistance gene were PCR amplified from pCRISPRyl (Addgene #70007) (Schwartz et al. ...
-
bioRxiv - Cell Biology 2023Quote: The sequence encoding Cepia3 was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated at the 3’ of the OMM-targeting sequence encoding the N-terminal 72 aminoacids of human TOM70.
-
bioRxiv - Bioengineering 2024Quote: ... inserts were PCR amplified from the epegRNA plasmids and from pCMV-PEmax (Addgene No. 174820) and inserted into the respective backbones (Addgene No ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the FUS was amplified by PCR from the plasmid pHR-FUSN-mCh-Cry2WT (Addgene, #101223) with primer set #3 (Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: The coding sequence of V5::TurboID was PCR-amplified from V5-TurboID-NES_pcDNA3 (#107169; Addgene). The two fragments were then ligated into the XhoI-digested pUASz1.0 vector using In-Fusion ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplified and cloned between SalI and XbaI sites of pAV-U6+27 (Addgene, plasmid #25709) to yield pAV-U6+27-RhoBAST2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR-amplified from a previously assembled vector (ppk10779-T2A-QF2-SV40, 3xP3-dsRed, Addgene accession #130667)
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Luc2TdTomato cassette was PCR amplified from the pcDNA3.1(+)/Luc2=TdT plasmid (Addgene, https://www.addgene.org/32904/)9 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bp::PhiC31 was made by PCR-amplifying the PhiC31 coding region from pPhiC31o54 (Addgene plasmid #13794) using an Xma1-tagged forward primer and a BsrG1-tagged reverse primer (see Supplementary Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Homology arms were PCR amplified and cloned into pHD-dsRed-attP (Gratz et al.,2014) (Addgene). Guide RNAs and the donor vector were co-injected into nosP Cas9 attP embryos at the following concentrations ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Neuroscience 2019Quote: The Sy-EKAR vector was created by PCR amplification of EKAR-GFP/RFP (38; Addgene #18680) to which a 4Gly linker domain (GGTGGCGGTGGA ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Microbiology 2021Quote: ... the 3xmCherry cassette was PCR amplified from pGGC026 (pGGC026 was a gift from Jan Lohmann (Addgene plasmid # 48831 ...
-
bioRxiv - Microbiology 2020Quote: ... CASP8 ORF was amplified from pcDNA3-CASP8 by PCR (Addgene #11817, a gift from Guy Salvesen) (Stennicke & Salvesen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we carried out PCR to amplify the mScarlet sequence from the ITPKA-mScarlet plasmid (Addgene, USA) as well as the GRB2 sequence from GRB2-YFP (gift from J ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
bioRxiv - Cell Biology 2022Quote: ... The mNeonGreen2 sequence was PCR amplified from pLenti6.2_mNeonGreen2 (a gift from Vanessa LaPointe; Addgene plasmid # 113727) and was inserted in the AscI tagging site using Gibson assembly.
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HaloTag sequence was obtained by PCR from pENTR4-HaloTag (gift from Eric Campeau, Addgene #29644). The donor plasmids for the ΔCTD ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Neuroscience 2021Quote: ... the U6-BbsI/BbsI cassette was PCR amplified from px458 (Addgene #48138, (Ran et al., 2013)) (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MCP-VP64-IRES-mCherry cassette was PCR amplified from the pJZC34 vector (Addgene, plasmid # 62331) and cloned into BsrGI/EcoRI digested lenti-sgRNA (MS2)-zeo backbone (Addgene ...