Labshake search
Citations for Addgene :
1 - 50 of 764 citations for Potassium Bromate 90 95% Chemical Purity 18O3 98% 100 Ug Ml In 18O Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... 90 ug of pMDLg/pRRE packaging plasmid (containing Gag & Pol, Addgene), 36 ug of pRSV-Rev packaging plasmid (containing Rev ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... 0.88 ug lentiviral transfer plasmid along with 0.66 ug pSPAX2 (Addgene plasmid #12260) and 0.44 ug pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Physiology 2021Quote: ... or PSD-95-pTagRFP (Addgene #52671), and cloned in using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 90% confluent HEK29T3 cells in 100 mm plates were transfected with pMD2.G (1.5 μg; Addgene plasmid # 12259), psPAX2 (3.0 μg ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 15 ug of psPAX2 (Addgene) were added into 3 ml OptiMEM (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.16 ug pMDLg/pRRE (Addgene #12251), 700 ng pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCAG_FingR.GFP-PSD-95-CCR5TC (Addgene 46295) were used to amplify the coding region with additional 5’ zinc finger binding sequence to regulate their expression20 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.2 ug pMD2.G (Addgene plasmid # 12259) and 10 ug of the plasmid of interest ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.5 ug pCMV-PE2 plasmid (Addgene #132775), 500 ng pegRNA plasmid (cloned into Addgene #132777) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: Three ug of pAAV2 vector (Addgene #89771) was digested with MluI/BstEII to release the insert between the two ITRs ...
-
bioRxiv - Immunology 2021Quote: ... and 0.44 ug pMD2.G (Addgene plasmid #12259), kind gifts from Didier Trono ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... pMD2.G and pRSV/Rev (2.88 ug total, Addgene) plus pMK1221-control or −GR shRNA (2.88 ug shCtrl or shGR ...
-
bioRxiv - Immunology 2023Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Microbiology 2020Quote: ... 36 ug of pRSV-Rev packaging plasmid (containing Rev, Addgene), 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.25 ug of left and right AAVS1 TALEN plasmids (Addgene plasmid no ...
-
bioRxiv - Genomics 2020Quote: ... we used 40 ug p2T CBh Cas9 BlastR (Addgene 71489), 40 ug gRNA plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251 ...
-
bioRxiv - Systems Biology 2019Quote: ... 90 ng pLR5-CBh-dCas9-hUtx-IRES-Hyg (Addgene, Plasmid #122374), 10 ng pCAG hyPBase [64] plasmids were transfected using Lipofectamine 3000 (Cat# L3000015 ...
-
bioRxiv - Microbiology 2020Quote: ... 18 ug of pMD2.g packaging plasmid (containing VSV-G envelope, Addgene). Transfection was performed using Lipofectamin 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2021Quote: ... (a gift from Loren Looger, Addgene plasmid # 98929; http://n2t.net/addgene:98929; RRID:Addgene_98929; 1013 vg/mL in water) was injected into the vitreous humour of wild type mice (C57BL/6J ...
-
bioRxiv - Neuroscience 2020Quote: GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299 ...
-
bioRxiv - Neuroscience 2021Quote: ... 100-200 nL of rAAV2-retro jGCaMP7s (~1e13 gc/mL, Addgene) was injected at a rate of 70 nL·min-1 using a Microinject system (World Precision Instruments) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931; http://n2t.net/addgene: 98931; RRID:Addgene_98931, 10 vg/mL in water) solution was injected with a blunt tip (30 gauge ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5ug of plasmid library was co-transfected with four ug PsPAX2 (Addgene #12260) and one ug pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... Each transfection condition contained 0.5 ug of a plasmid encoding GCaMP6s (Addgene #40753) and 1.5 ug of the plasmid encoding the appropriate olfactory receptor ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299) and subcloned with mScarlet-I into mammalian expression plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: ... guide sequences were cloned into the pX330 sgRNA expression plasmid 90 (Addgene plasmid 42230), and the full target site was cloned into pM427 ...
-
bioRxiv - Cancer Biology 2022Quote: ... a gift from Saumen Sarkar (Addgene plasmid # 32713; http://n2t.net/addgene:32713; RRID:Addgene_32713, (90)) and the Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... a viral vector for the expression of the genetically encoded calcium indicator GCaMP6f (pAAV.Syn.GCaMP6f.WPRE.SV40, Cat. Number #100837-AAV1, titre 1.3 x 1013, Addgene 95) was injected stereotaxically (Kopf ...
-
bioRxiv - Neuroscience 2020Quote: ... membrane-trafficking optimized variant was generated by fusing an additional trafficking signal from the potassium channel Kv2.112 to the C-terminus of Chrimson (pAAV-hSyn-somBiPOLES-mCerulean; Addgene #154945). For expression in GABAergic neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2-CAG-TdTomato (100 µL, 5.3 x 1012 GC/ml, Addgene 59462-AAV2) was injected intravitreally 4 mm posterior to the nasal aspect of the limbus ...
-
bioRxiv - Cell Biology 2021Quote: ... potassium channel and tdTomato (separated by an IRES) was generated by subcloning myc-mKCNJ2-T2A-Tomato.pCAG plasmid (#974, Addgene plasmid #60598) into a lentiviral backbone LeGo-iT2 (#809) ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Immunology 2021Quote: ... 80% confluent) were co-transfected with 2.4-ug of pLenti-pLex307-ACE lentiviral transfer plasmid (Addgene: 158448), 0.8-ug of pVSV-G ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...