Labshake search
Citations for Addgene :
1 - 50 of 441 citations for Plasmodium falciparum HRP II Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Microbiology 2020Quote: ... pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Microbiology 2021Quote: ... the pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Neuroscience 2022Quote: ... and pAAV-EF1a-SYP-HRP (Addgene, #117185) were subcloned into pAAV-Syn-DIO-MCS that had multicloning sites (MCS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HrpS was amplified from pBW213 (Addgene 61435), HrpR was amplified from pBW115 (Addgene 61434) ...
-
bioRxiv - Neuroscience 2020Quote: ... and of (ii) GluA2 (Addgene #24001) by replacing the corresponding pHluorin cDNA within these Addgene clones ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG-Pol-II WT and FLAG-Pol-II-Δ (entire CTD deleted) were gifts from Benjamin Blencowe (Addgene plasmids # 35175 and # 35176 respectively) ...
-
bioRxiv - Developmental Biology 2021Quote: ... or pIRES-hrGFP II-mTET1 (Addgene #83569), and cloned into the NotI digested PCDH-CAG-MCS-P2A-Puro vector (a kind gift from Dr ...
-
bioRxiv - Developmental Biology 2024Quote: ... and FSW-HRP-V5-LRRTM2 (Alice Ting, Addgene, #82537) plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAF-II cells stably expressing FUCas9Cherry (Addgene#70182) were transduced with MSMO1 sg RNA or FAXDC2 sgRNA along with pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Cancer Biology 2023Quote: ... (ii) HEK293T with 1.3 μg of psPAX2 (Addgene, #12260), 0.8 μg of pVSVG (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2020Quote: ... into the XhoI site of pBluescript II SK+ (Addgene, Watertown, MA) to create the plasmid pEcoRI_ASalxh.pBSKS.rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Neuroscience 2022Quote: ... COX4-dAPEX2 and SYP-HRP derived from pAAV-EF1a-COX4-dAPEX2 (Addgene, #117176) and pAAV-EF1a-SYP-HRP (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Immunology 2019Quote: ... The OT1 sequence was cloned from murine TCR OT1-2A.pMIG II (Addgene). The OT1-iR9-iPSC positive clones were further selected by Puromycin (1 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: Nos regulator elements drive the myosin II RLC (Eric Wieschaus56, Addgene 20163) fused to tdTomato (Michael Davidson ...
-
bioRxiv - Bioengineering 2020Quote: ... or pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) containing the CRMpMHCIIα constructs ...
-
bioRxiv - Plant Biology 2023Quote: ... A neomycin phosphotransferase II (NPTII) cassette (pICH47732::NOSp::NPTII, Addgene no. 51144) was used as selectable marker for plant transformation ...
-
bioRxiv - Genetics 2019Quote: ... mCherry fluorescent protein marker (Addgene), and ampicillin resistance gene ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Neuroscience 2024Quote: ... and ii) PCR fragment of FLPo originated from pTCAV-FLEx-FLPo (#67829, Addgene). Because a nuclear localization signal (NLS ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
Contractile acto-myosin network on nuclear envelope remnants positions human chromosomes for mitosisbioRxiv - Cell Biology 2019Quote: ... & MHC-GFP (pT3153, CMV-GFP-NMHC II-A, a gift from Robert Adelstein, AddGene #11347). For transfection of plasmids ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HS-SY-II and SYO1 synovial sarcoma cell lines were transduced with lentiCas9-Blast85 (Addgene, #52962) and selected using 20 μg/ml of blasticidin to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...