Labshake search
Citations for Addgene :
301 - 350 of 1322 citations for PDGF BB Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and also cloned spCas9nuclease with Chd4 sgRNA based on PX458-pSpCas9(BB)-2A-GFP (#48138, Addgene). Then ...
-
bioRxiv - Cancer Biology 2019Quote: ... The CRISPR/Cas9 plasmid pSpCas9n(BB)-2A-Puro was a gift from Feng Zhang (Addgene #48141). Lentiviral vectors for GFP-FAK wildtype and FAK kinase-dead (R454 ...
-
bioRxiv - Cancer Biology 2019Quote: ... annealed oligos (Supplemental Table 1) were inserted into pSpCas9(BB)–2A–Puro (PX459) V2.0 (Addgene, #62988) using the BbsI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... These two gRNAs were then subcloned into pSpCas9n(BB)-2A-GFP plasmid (pX461; Addgene No: 48140). We made use of Cas9 nickase (Cas9n ...
-
bioRxiv - Cancer Biology 2020Quote: ... Appropriate guide RNAs were separately cloned into the SpCas9(BB)-2A-GFP (PX458) vector (Addgene, 48138) or pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the plasmid pSpCas9(BB)-2A-GFP (PX458) (PX458 was a gift from Feng Zhang, Addgene #48138) in which a sgRNA targeting either an intergenic region of chromosome 8 (Ctrl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Genetics 2022Quote: ... Complementary gRNA oligonucleotides were cloned into pSpCas9(BB)-2A-Puro plasmid (pX459; Addgene plasmid ID# 48139) using the BbsI I site ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sgRNAs were cloned into the pX459 (pSpCas9 (BB)-2A-Puro) plasmid vector (Addgene, Cat#62988). Mouse or human cell lines were transfected with the abovementioned plasmids using Lipofectamine 3000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the BbsI site of pSpCas9(BB)-2A-GFP (pX458; Addgene, Cambridge, MA, USA). PX 458 was a gift from Feng Zhang (Addgene plasmid # 48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The gRNAs were first individually cloned into pX330-U6-BB-CBh-hSpCas9 plasmid (Addgene No: 42230) using BbsI site ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA oligos (GTAACGGCAGACTTCTCCTC) were ligated into the pSpCas9(BB)-2A-GFP (px458) vector (48138; Addgene). BEL-A cells (1.0 × 106 ...
-
bioRxiv - Cell Biology 2022Quote: ... GTCGTCGGCCCGCTTCCGGAAGG for RnArpC5 and GATCCACTCGGCGGAAGCGTGAGG for RnArpC5Lwere cloned into pSpCas9(BB)-2A-Puro (Addgene, ID 48139). Cells were transfected employing Lipofectamine™ LTX Reagent with PLUS™ Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from. Feng Zhang, Addgene #62988) using BbsI sites and confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: ... and an ISG54 promoter driving Nluc-2A-GFP cloned into the pSBbi-BB backbone (Addgene 60521).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987). After 24 h the cells were selected with puromycin and expanded ...
-
bioRxiv - Developmental Biology 2023Quote: The constructs for epigenome editing were based on the plasmid pSpCas9n(BB)-2A-GFP (Addgene #48140) (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sabaeus genome and cloned into pSpCas9(BB)-2A-Puro (a gift from Feng Zhang, Addgene # 62988) following the protocol in [68] ...
-
bioRxiv - Cancer Biology 2023Quote: ... obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458; RRID: Addgene_48138) following the protocol as defined by the Zhang lab [19] and sequenced for correct oligonucleotide insertion ...
-
bioRxiv - Genomics 2023Quote: ... guide RNAs (gRNAs) (Table S5) were cloned into pSpCas9(BB)-2A-Puro (pCas9-Puro, Addgene 62988) using BbsI Golden Gate reactions as described (Ran et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA was then cloned into a pSpCas9(BB)-2A-puro V2.0 (PX459) plasmid (Addgene #62988). The vector was used for organoid transfection using Lipofectamine® 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Both guide sequences were then cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (pX458) (Addgene plasmid ...
-
bioRxiv - Systems Biology 2023Quote: ... Three guides were ordered from Eurofins genomics and cloned into pSpCas9(BB)-2A-Puro (Addgene #48139) plasmids using a one-step restriction-ligation protocol (85) ...
-
bioRxiv - Genomics 2023Quote: Cas9 and the sgRNA were expressed from the pSpCas9(BB)-2A-GFP (PX458) plasmid from Addgene [72 ...
-
bioRxiv - Cell Biology 2023Quote: ... one of the gRNAs was cloned into SpCas9(BB)-2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the px330-mCherry plasmid (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA spacers were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, cat. #62988) as described previously 89 ...
-
bioRxiv - Cell Biology 2024Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... [34] for endogenous tagging and BbsI sites forpSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene 62988), for ATG14 knockouts ...
-
bioRxiv - Cell Biology 2024Quote: ... The pX459-sfCherry CRISPR-Cas9 vector were generated from pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Developmental Biology 2021Quote: ... All gRNAs were synthesized as oligonucleotides and cloned into the pSpCas9(BB)-2A-GFP plasmid (px458, Addgene) following the protocol of Ran et al(23) ...
-
bioRxiv - Developmental Biology 2020Quote: ... was seeded on MEF then transfected with two designed pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene #62988) plasmids using Lipofectamine 3000 (Thermofisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... pSPCas9n-2A-GFP (pSpCas9n(BB)-2A-GFP (PX461)) was a gift from Feng Zhang (Addgene plasmid #48140) [44] ...
-
bioRxiv - Cell Biology 2019Quote: ... the targeting sequence for LC3B (TTCTCCGACGGCATGGTGCA) was cloned into the pSpCas9 (BB)-2A-GFP plasmid (Addgene, 48138). Donor DNA for homology recombination consisted of a 1000-bp left homology arm ...
-
bioRxiv - Developmental Biology 2020Quote: ... sgRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang Lab; Addgene plasmid #62988; http://n2t.net/addgene:62988; RRID:Addgene_62988) according to the Zhang Lab General Cloning Protocol (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Guide RNAs (gRNAs) were cloned into a CRISPR/Cas9 plasmid hSpCas9(BB)-2A-GFP (PX458; Addgene #48138)63 ...
-
bioRxiv - Genomics 2021Quote: ... Guide RNAs TGCGACATAGTAGGGATAAC (gRNA1) and GCATTATCCACATTCATGTG (gRNA2) were cloned into plasmid pSpCas9(BB)-2A-GFP (Addgene #48138) by the company VectorBuilder and shipped as pRP[CRISPR]-EGFP-hCas9-U6> {VP_gRNA1} and pRP[CRISPR]-EGFP-hCas9-U6> {VP_gRNA2} ...
-
bioRxiv - Immunology 2021Quote: ... The knock out was performed by transfection of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene, USA), expressing a sgRNA (Ckap4 ...
-
bioRxiv - Neuroscience 2021Quote: ... we linearized the pSpCas9(BB)-2A-Puro (PX459) plasmid (a gift from Feng Zhang; Addgene plasmid # 48139) with BbsI and dephosphorylated it with calf intestinal alkaline phosphatase ...
-
bioRxiv - Cell Biology 2021Quote: Complimentary oligos were annealed and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene plasmid #62988) at the BbsI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... The pSpCas9(BB)-2A-Puro (PX459) V2.0 vector was a gift from Feng Zhang (Addgene plasmid # 62988). T4 polynucleotide kinase and T7 DNA ligase were from New England Biolabs (Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T knockout cell lines were generated by transient transfection of pSpCas9(BB)-2A-Puro (Addgene 48139) encoding U6 driven expression of sgRNAs (Scramble Guide ...
-
bioRxiv - Cell Biology 2021Quote: ... During sgRNA cloning the pSpCas9(BB)-2A-GFP (pX458) was used (a gift from Feng Zhang, Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pSpCas9(BB)-2A-GFP (PX458) vector expressing Cas9 endonuclease (gift from Feng Zhang, Addgene plasmid # 48138) was linked with a single-guide RNA (sgRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... An sgRNA for the TIGRE locus was cloned into pSptCas9(BB)-2A-Puro(PX459)-V2.0 (Addgene #62988) as previously described (Ran et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed sequences were cloned into an expression vector pSpCas9(BB)-2A-Puro(px459) (Addgene plasmid ID:48138) using BbsI restriction enzyme ...
-
bioRxiv - Genomics 2022Quote: ... guide RNAs (gRNAs) (Supplementary Table S8) were cloned into pSpCas9(BB)-2A-Puro (pCas9-Puro, Addgene #62988) or pSpCas9(BB)-2A-GFP (pCas9-GFP ...
-
bioRxiv - Cell Biology 2022Quote: ... Negative sgRNA and targeting sgRNA were separately inserted into pSpCas9(BB)-2A-GFP(PX458) (Addgene ID: 48138). Plasmid was transfected into H460 cells for 48 hours ...