Labshake search
Citations for Addgene :
301 - 350 of 1158 citations for P N Nonylphenol 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... OsTIR1 and AtAFB2 plasmids were used (AtAFB2) (pMK232 CMV-OsTIR1-PURO, Addgene #72834; pSH-EFIRES-P-AtAFB2-mCherry-weakNLS, Addgene #129717) [3,10] ...
-
bioRxiv - Cell Biology 2021Quote: ... a codon-optimized signal sequence from human ER-resident p23 was inserted into the AgeI site of p-sfGFP-N1 (Addgene #54737). p23ss-sfGFP lacking the stop codon was PCR amplified and flanked with a 3’ NheI site and TA cloned into pCRII-TOPO vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... iNPCs were transfected with a mixture of two plasmids that provide donor DNA for targeted knockin of CAG promoter-driven mCherry expression cassette at the AAVS1 loci (pAAVS1-P-CAG-mCherry, Addgene, # 80492), and that express Cas9 and sgRNA (pXAT2 ...
-
bioRxiv - Biochemistry 2023Quote: ... The sense guide insert was subsequently cloned into BbsI digested pBABED P U6 (University of Dundee DU48788) and the antisense cloned into BbsI digested pX335 (Addgene #42335), yielding clones DU69746 and DU69747 respectively.
-
bioRxiv - Biochemistry 2023Quote: ... Bpa-mutant Pet28n-6xHis-BRCA11-104-(GS)6-BARD126-221 plasmids were co- transformed with a pEVOL-pBpF plasmid encoding an Bpa aminoacyl tRNA synthetase (gift from P. Schultz, Addgene #31190) in E ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133; http://n2t.net/addgene:55133;RRID:Addgene_55133). mCherry tagged GalT was generated from Cerulean-GalT plasmid by replacing cerulean to mCherry using subcloning technology ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213925 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ; http://n2t.net/addgene:122848; RRID:Addgene_122848) (94 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072; http://n2t.net/addgene:123072; RRID:Addgene_123072) (94 ...
-
bioRxiv - Cell Biology 2021Quote: The Rho1 ORF (DGRC LD03419) was cloned into pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756).
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Immunology 2022Quote: ... The MSCV-N EBNA3A plasmid used as a backbone for PCR was a gift from Karl Munger (Addgene plasmid # 37956 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-vinculin head (residue 1-258) and the N-terminal fusion of vinculin-T12 were obtained from Addgene (#46270 ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... before using LR reaction to transfer the cDNA into destination vectors pLEX_305-C-dTAG or pLEX_305-N-dTAG (Addgene #91797 & #91798 ...
-
bioRxiv - Molecular Biology 2023Quote: ... To tag endogenous POLQ at the N-terminus with a 3xFLAG-LoxP-SV40-Puro-Lox-HaloTag (Addgene #86843), ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid for STIM1-mApple was prepared in our lab as described previously123 and that for mEmerald-TOMM20-N-10 was a gift from Michael Davidson (http://n2t.net/addgene:54282 ; RRID:Addgene_54282).
-
bioRxiv - Cancer Biology 2022Quote: ... Digested gBlocks were ligated to digested pGEX-6p1-N-HA (gift from Andrew Jackson & Martin Reijns, Addgene plasmid # 119756; http://n2t.net/addgene:119756; RRID:Addgene_119756). BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848; http://n2t.net/addgene:122848 ; RRID:Addgene_122848). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2022Quote: ... The constructs were LR-recombined into pDest-pcDNA3.1 with N-terminal FLAG-tag or into pLIX_403 (Plasmid #41395, Addgene) with C-terminal GFP-tag ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842; http://n2t.net/addgene:122842; RRID:Addgene_122842) (78).
-
bioRxiv - Biophysics 2023Quote: ... or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666). For coexpression ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ; http://n2t.net/addgene:75142 ; RRID:Addgene_75142) and (Addgene plasmid # 75143 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-hSyn-DIO-EGFP (Addgene; 100 nl) (Figure 1E ...
-
bioRxiv - Molecular Biology 2023Quote: ... A BRCA1-100 construct from Addgene (36) was subsequently introduced into the His- MBP-TEV-BARD126-777 vector by Gibson assembly in frame between the TEV site and BARD1 (37 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 100 ng pMD2.G (Addgene, #12259) with TransIT-Lenti (Mirus ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: Lhx6-Cre or Lhx6-Cre;Ppargc1aF/Fpups were injected at postnatal day (P)0 or P1 with 600nL of the following viral mix: AAV8-hSyn-dio-hM3D(Gq)-mCherry (Addgene #44361-AAV8) at a 1:40 dilution for sparse cell targeting ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125; http://n2t.net/addgene:54125; RRID: Addgene_54125).
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...