Labshake search
Citations for Addgene :
1 - 50 of 1446 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... a multiplexed gRNA cassette expressed with a Cestrum Yellow Leaf Curling Virus (CmYCLV) promoter and separated by Csy4 cleavage sites (Addgene ID: 91061), a blank homologous recombination module (Addgene ID ...
-
bioRxiv - Molecular Biology 2022Quote: ... eiF4E6(GGGGATCCGCCGAACAAGGG) or Yellow (Addgene #49331) guide sequences were inserted ...
-
bioRxiv - Neuroscience 2023Quote: ... and pZac2.1 gfaABC1D-lck-GCaMP6f virus (Addgene virus #52924).
-
bioRxiv - Neuroscience 2020Quote: ... The virus (Addgene plasmid pAAV-hSyn-Flpo ...
-
bioRxiv - Neuroscience 2024Quote: ... virus made by Addgene with a titer of 2.3×1010 vg/mL) ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Neuroscience 2024Quote: The virus constructs used were adeno-associated virus (AAV) purchased from Addgene (Massachussets, USA), with capsid AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: Virus: We used an adeno-associated virus AAV-LEX-rev-ChR2-tdtomato (Addgene 18917) to express channelrhodopsin2 in CA3 pyramidal cells in a cre-lox-dependent manner ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV-CamKII-Cre virus (Addgene) was diluted 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was obtained from Addgene. During surgery ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus pAAV.CAG.GCaMP6s.WPRE.SV40 (Plasmid #100844, Addgene) was injected into the plantar area of the hindpaw using a 10 μl Hamilton syringe with a cannula connected to a 30G needle ...
-
bioRxiv - Neuroscience 2022Quote: ... The GCaMP6 virus (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene; titre ...
-
bioRxiv - Neuroscience 2022Quote: ... The virus was produced by Addgene or the Virus Facility of the University Medical Center Eppendorf ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1.CaMKIIa.hChR2(H134R)-eYFP.WPRE.hGH virus (Addgene) was infused bilaterally in the infralimbic cortex (IL ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-packaged constructs (Addgene, virus # 107790) expressed GCaMP6s under the CaMKIIα promoter to achieve pyramidal cell-predominant expression (Wood et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... virus and pAAV.CAG.LSL.tdTomato (Addgene, stock #100048) virus ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TdTomato (FUtdTW virus; Addgene #22478) were purified by fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Neuroscience 2020Quote: ... GCaMP6s virus (pAAV.Syn.DIO.GCaMP6s.WPRE.SV40) was obtained from Addgene, Rabies-EGFP virus (EnvA G-deleted Rabies-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-DIO-GCaMP7s virus from Addgene #104491-AAV1 110 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV9.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, MA, USA) was added to the cultures at a final concentration of 1 μl/mL for GCaMP6f expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... Clones expressing EGFP (FUGW virus; Addgene #14883) and TdTomato (FUtdTW virus ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Neuroscience 2024Quote: The following virus vectors were used for experiments: adeno-associated virus (AAV)1-Syn-Flex-ChrimsonR-Tdtomato (Addgene #62723), AAV2retro-cFos-tTA-pA (Addgene #66794) ...
-
bioRxiv - Neuroscience 2020Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1) (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into cortex (viral titer ...
-
bioRxiv - Neuroscience 2021Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1)42 was delivered using a Picospritzer III (Parker ...
-
bioRxiv - Neuroscience 2021Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into barrel cortex (1:10k-1:50k dilution ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-S5E2-dTom-nlsdTom virus (Addgene number: 135630) was packaged by the Janelia Vector core with AAV2/9 serotype (virus titer after 1:1 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... The virus package plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Neuroscience 2023Quote: ... virus titer 2.7 x 1013 (AddGene Plasmid #105540). The skull was sealed with bone wax (Med Vet International ...
-
bioRxiv - Neuroscience 2023Quote: ... virus or AAV2- FLEX-sun1GFP (Addgene plasmid# 160141) control virus were packaged by SignaGen at high-titer (1 × 103 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV5.Syn.Flex.GCaMP6f.WPRE.SV40 virus was obtained from Addgene.
-
bioRxiv - Physiology 2022Quote: ... AAV8-TBG-Null virus (Addgene, AV-8-PV0148) was used as a control.
-
bioRxiv - Neuroscience 2024Quote: ... or control AAV2-hSyn-mCherry virus (RRID: Addgene_114472) was injected into the LHb ...
-
bioRxiv - Neuroscience 2023Quote: ... this same virus (AAV8-CaMKIIa-hM4Di-mCherry, Addgene) was bilaterally infused into two sites in vlOFC (0.2 μl ...
-
bioRxiv - Neuroscience 2022Quote: ... infected with Syn- iGluSnFR virus (Addgene #98929-AAV1) at DIV11-14 ...
-
bioRxiv - Neuroscience 2023Quote: ... a retrograde virus (AAV-Retrograde-Cre, Addgene #55636) and a cre-dependent virus (AAV9-DIO-Ef1a-eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV2retro-CamKIIa-jGCaMP8s-WRPE virus (Addgene #176752) was used for long-term imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV10-CamKII-GCaMP6f-WPRE virus (Addgene #100834) was used to obtain parameters utilized in video simulations and to calculate inter-session missalignment (Extended Data Fig ...
-
bioRxiv - Bioengineering 2024Quote: The pLV-CMV-LoxP-DsRed-LoxP-eGFP plasmid used to produce virus (termed Traffic Light virus) was purchased from Addgene (#65726). HEK-293T cells were seeded into T175 flask at the density of 20 million/ flask ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Neuroscience 2020Quote: ... was mediated by a co-administration of a trans-synaptic CAV2-Cre virus (Plateforme de Vectorologie de Montpellier (PVM)) and a pAAV8-hSyn-DIO-hM4D(Gi)-mCherry virus (Addgene; plasmid #44362) while that of the mChrerry reporter alone was mediated by co-administration of the CAV2-Cre virus and a pAAV8-hSyn-DIO-mCherry virus (Addgene ...