Labshake search
Citations for Addgene :
1 - 50 of 465 citations for Nuclear pore complex protein Nup93 dye Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: Nuclear-targeting Csm complex plasmid construction has been described previously12 (Addgene plasmid #195242). Cytoplasmic-targeting Csm complex plasmid was modified from this by removing the NLS sequences before each protein sequence ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear-localized mCherry was digested from pBRY-nuclear mCherry-IRES-PURO (Addgene plasmid 52409) and the ~860bp band was gel purified ...
-
bioRxiv - Cancer Biology 2023Quote: ... we replaced the VP64-P65-Rta sequence (encoding transcription activator complex) in the lentiviral vector of dCas9-VPR-mCherry fusion protein (for CRISPRa, Addgene #102245) with the KRAB-MECP2 sequence from the transient expression vector of dCas9-KRAB-MECP2 (for CRISPRi ...
-
bioRxiv - Bioengineering 2024Quote: ... H2B-iRFP nuclear marker was (Addgene Plasmid #90237). ELP48 was obtained from Addgene (Addgene Plasmid #68395) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The SV40 nuclear localization sequence (CACTTTCCGCTTTTTCTTTGG, Addgene plasmid #39319) was cloned downstream the tagBFP combining inverse PCR and blunt end ligation (T4 Ligase NEB) ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... which encodes nuclear GFP and membrane TdTomato (Addgene, plasmid #26771). For the rescue experiment ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 6ug nuclear-localized GFP construct (Addgene #67652) using Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR complex was derived from lenti-EF1a-dCas9-VPR-Puro (Addgene 99373, Ho et al., 2017) and modified to abolish BsmBI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... pombe NatB acetylase complex (Johnson, Coulton, Geeves, & Mulvihill, 2010) using pNatB plasmid (pACYCduet-naa20-naa25, Addgene, #53613 ...
-
bioRxiv - Molecular Biology 2023Quote: ... After an incubation of 1h at room temperature with a pA-Tn5 adapter complex (Addgene #124601), the Tn5 enzyme tagmentation reaction was performed by adding a buffer containing MgCl2 to the samples and incubating for 1h at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... IPT3 promoter was cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), tdTOMATO CDS ...
-
bioRxiv - Microbiology 2023Quote: The eSpCas9(1.1) gene containing two nuclear localization signals (NLS) was obtained from Addgene (Plasmid #71814) and cloned into the pST32 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclear Cas9 mRNA was synthesised from the linearised pT3TSnCas9n plasmid (Addgene 46757, a gift from Alexis Eschstruth) (Jao et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex (Cas9 with tracrRNA for LMNB1 gene) (IDT) and 400 ng of LMNB1_mTagRFP-T HDR plasmid (Addgene 114403). Nucleofection was done with the pulses DN-100 ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear (CMV-NLS-R-GECO) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and 32462) [40,41] ...
-
bioRxiv - Cell Biology 2021Quote: Measurement of NFAT4 nuclear translocation in HEK293 cells was achieved by transient overexpression of NFAT4-GFP (Addgene #21664) as previously described(30 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Nuclear EKAR (Cerulean-Venus) was a gift from Karel Svoboda (Janelia Research Campus, Virginia, USA; Addgene plasmid #18682), biosensor Epac-SH187 was a gift from Kees Jalink (The Netherlands Cancer Institute ...
-
bioRxiv - Cancer Biology 2022Quote: ... SK-N-DZ cells expressing dCas9-VP64 were transduced with lentiviral particles encoding the p65-HSF1 transactivator complex (pLentiMPH2, Addgene plasmid #89308 was a gift from Feng Zhang) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Cas6) fused to a nuclear localization signal (NLS) and RNA guide was a gift from Jennifer Doudna (Addgene plasmid #195240 ...
-
bioRxiv - Genetics 2023Quote: ... Cells were co-transfected with Cas9-gRNA RNP complex together with the repair oligo and Puromyin-GFP plasmid39 (Addgene, Watertown, MA) using Lipofectamine Stem transfection reagent (ThermoFisher ...
-
bioRxiv - Developmental Biology 2024Quote: pCAGG-NLS-Cas9-NLS (expressing nuclear localised S. pyogenes Cas9 under the expression of CAGC promoter) was a gift from Marianne Bronner (Addgene plasmid # 99138 ...
-
bioRxiv - Cancer Biology 2024Quote: ... lentivirus for the red-fluorescent nuclear reporters were produced using a mix of 1.8 μg gag/pol packaging plasmid (Addgene #14887), 0.7 μg pRev packaging plasmid (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The resulting HeLa-dCas9 cells were then transduced with the lentiviral construct for the MS2-P65-HSF1 (MPH) activator complex (Addgene 61426-LVC) and selected with 0.5 mg/ml hygromycin ...
-
bioRxiv - Neuroscience 2021Quote: ... Cre-dependent GCaMP6s plasmid labeled with nuclear dTomato (pAAV-EF1α-DIO-GCaMP6s-P2A-NLS-dTomato) was acquired from Addgene (plasmid #51082). Cre expression plasmids ...
-
bioRxiv - Molecular Biology 2020Quote: ... Casper strains were available and 20 ng/μL DNA plasmids encoding mNG-GECO1 under the control of nuclear-localized elavl3/HuC promoter (Addgene: 59530) were injected into two-cell stage embryos of Casper mutant zebrafish33 with 40 ng/μl Tol2 transposase mRNA (26 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2013) comprising overhangs was synthesized by Synbio Technologies and cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), turbo GFP (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... The human cancer cells and the Atm MEFs were stably modified with lentiviral vectors to express the nuclear rupture reporter NLS-GFP (pCDH-CMV-NLS-copGFP-EF1-blastiS, available through Addgene (#132772)) (Denais et al. ...
-
bioRxiv - Cancer Biology 2022Quote: MDA-468 cell lines were stably modified with lentiviral vectors to express the nuclear reporter NLS-GFP (pCDH-CMV-NLS-copGFP-EF1-blastiS [30], available through Addgene (#132772)) ...
-
bioRxiv - Bioengineering 2023Quote: The dead Cas9 coding sequence (dCas9) including nuclear localization signals was obtained from pEG302 22aa SunTag VP64 nog (Addgene plasmid #120251). DNA fragments encoding different copy numbers of the GP41 peptide separated by a 5 amino acids GS linkers were derived from the plasmid 24×MoonTag-kif18b-24×PP7 (addgene plasmid #128604 ...
-
bioRxiv - Cell Biology 2024Quote: ... We generated scFV-GFP by removing the nuclear localization sequence via an early stop codon from pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE (Addgene #60906) with the following primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and flanking triple SV40 nuclear localization sequences (3×NLS): 3×NLS-CASPEX (a derivative of the original CASPEX plasmid (Addgene #97421) generated by Myers et al ...
-
bioRxiv - Cancer Biology 2023Quote: GFP protein fused with a nuclear localization signal (GFP-NLS) was stably transduced into HDFs using lentiviruses (pTRIP-SFFV-EGFP-NLS; Addgene, Cat# 86677). Cells were cultured on eight-well coverslip-bottomed slides (ibidi GmbH ...
-
bioRxiv - Bioengineering 2022Quote: ... which was constructed by fusing two nuclear localization signals to both of C- and N-terminal of pCMV-PE2-SpG (Addgene plasmid #159978), and pCMV-PEmax-SpG-P2A-hMLH1dn ...
-
bioRxiv - Neuroscience 2024Quote: ... pro-lentiviral vector1 containing a 476 bp human synapsin-1 promoter element driving the neuronal specific expression of HA-tagged SpCas9 flanked by the bipartite SV40 nuclear localization signal (NLS) HA-NLS-SpCas9-NLS (from Addgene, plasmid #131497) at AgeI and BsrGI sites followed by woodchuck hepatitis post-transcriptional regulatory element (WPRE ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM DTT) to remove any unreacted dye and were incubated with 0.2 µM TEV protease (expressed from pRK793 (Addgene plasmid # 8827) and purified from E ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.