Labshake search
Citations for Addgene :
101 - 150 of 1130 citations for Nipah Virus Glycoprotein F Recombinant Protein Mouse Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... a virus solution (rAAV1-hSyn-jGCamP7f, 104488-AAV1, Addgene) was injected under stereotaxic conditions (400 nL ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV-hSynapsin1-FLEx-axon-GCaMP6s virus (Addgene, MA, USA) was injected bilaterally ...
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: ... adeno-associated virus encoding AAV8-hSyn-DIO-hM3Dq.mcherry (Addgene #44361 ...
-
bioRxiv - Neuroscience 2023Quote: ... except that a retrograde-cre virus (pENN.AAV.hSyn.Cre.WPRE.hGH; Addgene #105553) or sterile PBS was injected bilaterally in the IC of 6-8 week old GtACR1 fl/fl mice (Jackson stock # 033089 ...
-
bioRxiv - Biophysics 2023Quote: ... and the virus envelope plasmid pMD2.G (Addgene #12259) using JetPRIME (Polyplus-transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... tobacco vein mottling virus protease (TVMVp; Addgene Plasmid #8832), and human rhinovirus 3C protease (HRV 3Cp ...
-
bioRxiv - Neuroscience 2024Quote: ... 250 nl of AAVrg-CAG-mCherry virus (Addgene #59462) were intracranially injected unilaterally at 50 nl/min in the anterior cingulate cortex (ACC ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Physiology 2022Quote: ... Maternal hepatocyte-specific YAP1 deletion was achieved by injecting mice with the adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (AAV8-TBG-Cre virus, Addgene, AV-8-PV1091) via tail vein at a dose of 1×1012 genomic copies/mouse ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or EGFP (pQCXIP-EGFP-F, Addgene #73014). MIA PaCa-2 WT-RFP were mixed 1:1 with TSC1/TSC2 KO-GFP cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and C1-F-tractin-mCherry (Addgene; 155218), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Plant Biology 2021Quote: ... and Cas9 RNP nucleofection were performed according to Huang et al.30 Cas9 recombinant protein was overexpressed in Escherichia coli BL21 harboring the plasmid pMJ915 (Addgene # 69090). Cas9 protein was purified and stored at −80°C in Cas9 RNP buffer (20 mM HEPES at pH 7.5 ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV5-hGFAP*-Cre virus was obtained from Addgene (#105550), in which Cre is driven by the 2.2-kb gfa2 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... the control virus AAV5-CAG-Flex-tdTomato (200 nL, Addgene) was used to anterogradely label MCPO GABAergic axons ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV5-Syn.Flex.GCaMP6s virus was obtained from Addgene (http://www.addgene.org/).
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-EGFP (Addgene, 50457-AAV5; Control Virus) and were given 4 weeks for recovery and viral expression (Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV1.CaMKIIa.hChR2(H134R)-eYFP.WPRE.hGH virus (Penn Vector Core, Addgene 269696P ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) or the control virus (pAAV8-hSyn-DIO-mCherry, Addgene) to the GABAergic neurons of the lOFC (coordinates ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV9-CaMKIIα-GCaMP6f (Addgene, Cambridge, MA). The coordinates used for the guide cannulae targeting ACC (Cg1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-eGFP (Addgene, Cambridge, MA). In the imaging experiment ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM3D(Gq)-mCherry (Addgene viral prep # 50476-AAV8 ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM4D(Gi)-mCherry (Addgene viral prep # 50477-AAV8 ...
-
bioRxiv - Neuroscience 2020Quote: ... For control an AAV8-hSyn-DIO-mCherry virus (Addgene, USA) was injected in the same position in 6 PV-Cre animals ...
-
bioRxiv - Neuroscience 2022Quote: ... Each infusion contained an adeno-associated virus (AAV) from Addgene, bearing the gene construct for either an inhibitory or excitatory DREADD (Designer Receptor Exclusively Activated by Designer Drugs ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV-BFP-Cre virus (AAVpmSyn1-EBFP-Cre, Addgene#51507) was injected via the syringe into the tissue at a rate of 40nl/min for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre or GFP expressing adeno-associated virus (GFP pAAV.CMV.PI.EGFP.WPRE.bGH, Addgene 105530 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-retro virus (rAAV1-retro-EF1a-DO_DIO_TdTomato_EGFP-WPRE-pA, Addgene #37120 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Developmental Biology 2020Quote: ... gRNA oligos for WNT11 (F: CACCGGTCCTCGCTCCTGCGTGGGG; R: AAACCCCCACGCAGGAGCGAGGACC) and PAX2 (F: CACCGATGACCGCCACTAGTTACCG; R: AAACCGGTAACTAGTGGCGGTCATC) were synthesized and cloned into the lentiCRISPR v2 plasmid (Addgene # 52961). First ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Cancer Biology 2019Quote: Virus rich media (VRM) of the Cas9-Blast plasmid (Addgene: #52962) was infected into regular AML lines using the standard lentivirus infection protocol described below ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudotyped rabies virus (SAD B19 strain, EnvA-RbV-GFP, Addgene# 52487) was commercially obtained from the Janelia Viral Tools Facility stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... or a control virus (AAV5-hSyn-DIO-EGFP; Addgene, 50457-AAV5) targeting the CeA ...
-
bioRxiv - Neuroscience 2022Quote: ... GCaMP6s virus (AAV-DJ-Ef1a-DIO-GCaMP6s) was obtained from Addgene, Tet-tox virus (AAV-CBA-DIO-GFP-TetTox-WPRE-bHGpA ...
-
bioRxiv - Neuroscience 2020Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 virus (titer: 2.2 × 1013 GC/mL, obtained from AddGene, USA) was injected into dorsal hippocampus (AP -2.1 ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 μL AAV pCAG-FLEX-EGFP-WPRE virus (Addgene, Cambridge, MA) was injected into the NTS ...
-
bioRxiv - Immunology 2020Quote: ... and a murine leukemia virus (MLV) Gag-Pol plasmid (Addgene # 14887) were purified using the Endo-Free Plasmid Maxi Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV-hSyn-DIO-GCaMP7f-WPRE (AAV9 virus) are from Addgene.
-
bioRxiv - Neuroscience 2022Quote: ... the adeno-associated virus AAV1.CAG.FLEX.tdTomato.WPRE.bGH (#59462, Addgene, Watertown, MA, USA) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...