Labshake search
Citations for Addgene :
351 - 400 of 1482 citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
bioRxiv - Cell Biology 2023Quote: ... Obtained pcDNA-Halo was further digested with HindIII/Bam-HI restriction enzymes and ligated with the NPM insert (obtained by PCR amplification from eGFP-NPM (17578 Addgene) with our primers 5’-CCCAAGCTTCCACCATGGAAGATTCGATGGACATGG-3’ and 5’-CGGGATCCAAGAGACTTCCTCCACTGCC-3’ ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids for his-FUSLC (residue 1 to 163) and LAF-1 RGG (residue 1 to 168) were acquired from Addgene (https://www.addgene.org/127192/ (Fawzi laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding integrin β4 was amplified from pcDNA3.1/Myc-His beta4 (a gift from Filippo Giancotti, Addgene #16039), and then inserted into the pEGFP-N1 vector for the expression of β4-GFP ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the human CRISPRi v2 library (Addgene #83969) (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human NKCC1 coding sequence was derived from Addgene plasmid # 49077 ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...
-
bioRxiv - Microbiology 2020Quote: ... the human hACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Cancer Biology 2021Quote: Wild-type TP53 from both human (Addgene plasmid #69003) or zebrafish (3 days old embryos cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: Human GeCKO v2 library was obtained from Addgene (#1000000048) and amplified according to the provided instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD63 (Addgene plasmid #62964, gift from Paul Luzio) and mScarlet25 (Addgene plasmid #85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... the Bassik Human CRISPR Knockout Library (Addgene, 101926-101934) is separated into 9 sublibraries comprising a total of 225,171 elements and targeting approximately 20,500 genes (10 sgRNAs per target) ...
-
bioRxiv - Neuroscience 2023Quote: ... under the human synapsin promoter were obtained from Addgene. All viruses were stored at -80°C and aliquots were thawed over wet ice immediately prior to injection.
-
bioRxiv - Microbiology 2023Quote: The human “Brunello” CRISPR knockout pooled library (#73179, Addgene) (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: Human CRISPRi sgRNA library Dolcetto Set A17 (Addgene #92385) was transformed into electrocompetent Lucigen Endura™ E ...
-
bioRxiv - Neuroscience 2022Quote: The human Dolcetto CRISPR inhibition pooled library (Addgene #92385), and the plasmids pLX_311-KRAB-dCas9 (Addgene #96918) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human STIM1-CFP plasmid (52) was from Addgene (#19755). CAV1-mEGFP plasmid (53 ...
-
bioRxiv - Molecular Biology 2023Quote: The Human GeCKOv2 CRISPR knockout pooled library19 (Addgene 1000000048), which contains 6 sgRNAs for each gene and 2,000 non-targeting control sgRNAs ...
-
bioRxiv - Immunology 2023Quote: The human genome-wide CRISPRa-V2 library (Addgene 1000000091) was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260 ...
-
bioRxiv - Immunology 2023Quote: ... The GeCKO V2 human CRISPR knockout library from Addgene was then introduced into Endura Electrocompetent Cells by means of electroporation using a Bio-Rad Gene Pulser ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiCRISPR v2 GeCKO Human library (Addgene plasmid #52961) was amplified following Sanjana et al. ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: The human α-SYN wild-type (Addgene ID #36046) and α-SYN (wt)-141C (Addgene ID #108866 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human LATS1 expression plasmids were obtained from Addgene (41156). Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
bioRxiv - Neuroscience 2023Quote: ... a human codon optimized FLAG-Cas9 cDNA (Addgene 42230) was modified by C-terminal insertion of an additional nuclear localization signal and a 6-His tag ...
-
bioRxiv - Microbiology 2023Quote: ... human CRISPR Brunello lentiviral pooled libraries (#73179-LV; Addgene) were added to the cell culture at an MOI of 0.25 in the presence of polybrene (Santa Cruz ...
-
bioRxiv - Zoology 2023Quote: ... or a human TLR4 expression clone (Addgene, cat. #13018). Additionally ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2019Quote: A plasmid for SpCas9 expression (2x NLS and C-terminal His tag, pET-28a) was a gift from the Gao group (Addgene #98158).50 E ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Biophysics 2024Quote: The expression plasmid for HIS-tagged AavLEA1 was obtained from the Addgene plasmid repository [pET15b-AavLEA1 was a gift from Claude Férec (Addgene plasmid # 53093)]52 The expression plasmid for HIS-tagged RvLEAMshort was made by inserting a truncated cDNA from pEThT-RvLEAM49 [pEThT-RvLEAM was a gift from Takekazu Kunieda (Addgene plasmid # 90033)] ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...