Labshake search
Citations for Addgene :
501 - 550 of 2039 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with plasmids containing the packaging psPAX2 (Addgene, 12260, from Didier Trono) and envelope pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Immunology 2021Quote: ... were subcloned into the lentiviral pLKO.3G vector containing an eGFP cassette (Addgene #14748), by transferring the BamHI-NdeI restriction fragments containing the shRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: Separate lentivectors containing spCas9 (lentiCas9-Blast a gift from Feng Zhang (Addgene plasmid # 52962) and sgRNA (lentiGuide-Puro a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961) were produced in 293T cells as previously described18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Genomics 2022Quote: Plasmids containing dCas9-VPR (SP-dCas9-VPR was a gift from George Church (Addgene plasmid # 63798 ...
-
bioRxiv - Genomics 2020Quote: SpCas9 gRNAs were cloned into a Tol2-transposon-containing gRNA expression plasmid (Addgene 71485) 59. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... a transfer plasmid containing rat Synapsin promoter and cDNA encoding GCaMP6s (Addgene plasmid #40753) was assembled and transfected with helper-free DJ plasmids (Cell Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmid containing RelA or p50 was co-transformed with pEVOL-pAzF (Plasmid #31186, Addgene), the plasmid encoding the aaRS/tRNA pair for incorporating the unnatural amino acid p-azidophenylalanine (pAzF ...
-
bioRxiv - Microbiology 2021Quote: ... SpyCatcher/Spy-tag and SUMO containing plasmids were purchased from Addgene (#133449 and #111560).
-
bioRxiv - Cancer Biology 2021Quote: A549 cells were stably transduced with a lentiviral vector containing H2B-GFP (Addgene #25999) and a lentiviral vector containing DHB-iRFP ...
-
bioRxiv - Cell Biology 2022Quote: Microtubules were visualised by expressing a plasmid containing β-tubulin-mCherry (Addgene plasmid #175829).
-
bioRxiv - Cell Biology 2022Quote: ... for insertion into a dCas9-EGFP containing backbone (pHAGE-TO-dCas9-3XEGFP (#64107; Addgene)) ...
-
bioRxiv - Biochemistry 2019Quote: ... on a 3kb plasmid containing a single 601 sequence (pGEM3Z-601 from Addgene #26656) were performed as previously described (32 ...
-
bioRxiv - Neuroscience 2019Quote: ... 600nl of a viral vector containing either pAAV5-hSyn-hM4D(Gi)-mCherry (hM4Di; Addgene viral prep ...
-
bioRxiv - Genetics 2020Quote: ... gRNA-containing plasmids were generated in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene; 62988) (Ran et al ...
-
bioRxiv - Biochemistry 2021Quote: ... as a guide RNA (gRNA) and electroporated into HME63 already containing pCas9 (Addgene: 42876). The dnaB gRNA was designed to be centered on the desired mutation site and at the closest adjacent PAM sequence (5’-NGG) ...
-
bioRxiv - Immunology 2022Quote: ... a plasmid containing the promoter region of Mus musculus iNos was obtained from Addgene (pGL2-NOS2 Promoter-Luciferase – Plasmid # 19296 from Charles Lowenstein).44 The following primers were designed and used to amplify the promoter for the gene of interest and incorporate XhoI and BamHI sites at the 5’ and 3’ ends ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type MEFs were transduced with lentiviral particles containing the plasmids lentiMPHv2 (Addgene #89308) and lentiSAMv2 (Addgene #75112) ...
-
bioRxiv - Bioengineering 2023Quote: ... coli were transformed with plasmid containing the ampicillin resistance gene (pUC19, Addgene Plasmid #50005) and streaked on LB agar plates spiked with 100 µg/mL ampicillin ...
-
bioRxiv - Immunology 2023Quote: ... pLentiCRISPR-v2 containing guides were transfected wiTHPSPAX2 (Addgene #12260, a gift from Didier Trono) and pMD2.G to generate lentiviral particles ...
-
bioRxiv - Cancer Biology 2023Quote: ... Separate lentivectors containing spCas9 (lentiCas9-Blast a gift from Feng Zhang (Addgene plasmid # 52962) and sgRNA (lentiGuide-Puro a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cell Biology 2023Quote: ... The CYFIP2-mCherry containing plasmid was a gift from Josef Kittler (Addgene plasmid # 122052). The ECFP-betaPIXa containing plasmid was a gift from Rick Horwitz (addgene #15235) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing scFvs targeting TNFRSF8 or TMPRESS11E were cloned into pSLCAR-CD19-BBz (Addgene #135992) using NEB HiFi DNA assembly ...
-
bioRxiv - Cancer Biology 2023Quote: ... All plasmids containing the CD19 targeting ABD FMC63 are available from Addgene (#200670-#200681).
-
bioRxiv - Biochemistry 2023Quote: Plasmids containing human BRCA1 cDNA were a gift from Junjie Chen (Addgene, Plasmid #99394). We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... oligos containing the CRISPR sequence of YBR209W were inserted into pWS082 (Addgene plasmid #90516), the template plasmid of sgRNA cassette ...
-
bioRxiv - Genomics 2023Quote: ... oligos containing the CRISPR sequence (table S1) were inserted into pWS082 (Addgene plasmid #90516), the template plasmid of sgRNA cassette ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids containing pMSCVhygro-Ezh2 (#24926) or pMSCVhygro-Ezh2-F667I (#24927) were purchased from Addgene. Vectors encoding wild type TRα1 (pCMV-Flag-TRα1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Oligonucleotides containing gRNA sequences were first cloned into sgRNA expression vectors (Addgene #53186-53189) and then multiple gRNA cassettes were cloned into lentiviral expression vectors (pLV hUbC-Cas9-T2A-GFP ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Synthetic Biology 2020Quote: Expression vector encoding humanized pCas9_GFP protein was obtained from Addgene.org (Plasmid #44719) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...