Labshake search
Citations for Addgene :
351 - 400 of 2645 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Plasmids containing a mammalian codon-optimized dCas9-VP64 activator (pMLM3705, AddGene #47754) and single-chain gRNA encoding plasmid (MLM3636 ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmids containing the SpyCatcher and SpyTag sequences were ordered from Addgene. The plasmid pETDuet-MBP-8His was generated as previously described (Pan et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... and introduced in a construct containing a selection cassette (pDD282, Addgene #66823) using NEBuilder HiFi DNA Assembly Mix to generate plasmid pJHR2 (Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA-resistant CPAP cDNA containing plasmid was obtained from Addgene (#46390). Full-length and C-terminal coding sequences (residues 895-1338 CP3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... shRNA containing lentiviral constructs or a scrambled lentivrial construct (Addgene plasmid #162011) together with psPAX-2 (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... iGLUTs were plated in media containing individual target gRNA vectors (Addgene 99374), either targeting CALN1 or TMEM219 eGenes or scramble controls ...
-
bioRxiv - Bioengineering 2023Quote: ... and cloned into chimeric U6 promoter containing sgRNA cloning plasmid (Addgene #47108) and/or an MS2 loop containing plasmid backbone (Addgene #61424 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid containing chTOG cDNA was a gift from Stephen Royle (Addgene plasmid # 69108 ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA-containing plentiCRISPRv2 plasmids were co-transfected with psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were first infected with lentivirus containing lentiCas9-Blast plasmid (Addgene, # 52962) using similar spinfection protocol described above ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pUS252b (containing fuGFPb) was a gift from Nicholas Coleman (Addgene plasmid #191831). pJL1-eforRed ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid containing the cDNA encoding TurboID was purchased from Addgene (107169). The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST ...
-
bioRxiv - Genomics 2024Quote: ... we used a SaCas9 and GFP-containing backbone (Addgene #118836, plasmid pTRI211) into which was cloned the SaCas9-CTG sgRNA to give plasmid pTRI 212.
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids containing the CAST system were derived from pSL1142 (Addgene plasmid #160730).33 All experiments were performed in wild-type (WT ...
-
bioRxiv - Cancer Biology 2024Quote: peGFP-C1 vectors containing full-length Rab27B (GFP-Rab27B, Addgene plasmid #89447) and mutant forms of Rab27B that encoded constitutively active Q78L (GFP-Rab27B Q78L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Biophysics 2021Quote: The plasmid containing yeast (Saccharomyces cerevisiae) Ubr1 was purchased from Addgene (plasmid # 24506) 41 ...
-
bioRxiv - Genomics 2019Quote: The expression vector containing the PA-Tnp fusion construct is available from Addgene under accession number 121137 ...
-
bioRxiv - Developmental Biology 2019Quote: The lentiCRISPRv2-mCherry plasmid containing cas9 and Cherry fragments was purchased from Addgene (#99154 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the gene of interest containing pLJM1 lentiviral packaging plasmids (Addgene, catalog #91980) at concentrations of 1.3 pmol ...
-
bioRxiv - Biochemistry 2021Quote: ... was inserted into a vector PX601-containing wild-type SaCas9 (Addgene plasmid #61591) and replacing that domain of SaCas9 ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Genetics 2019Quote: ... The plasmid containing Enhanced SpCas9 (version 1.1, Addgene #71814, Slaymaker et al., 2016) was a generous gift of Carine Giovannangeli from the Museum National d’Histoire Naturelle ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The fragment containing the LbCpf1 coding sequence was amplified from pY016 hLbCpf1 (Addgene plasmid # 69988 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids containing coding regions for the FPs mKate (mKate-H4-23, Addgene 56061), mRUBY (GCaMP6f-mRUBY ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Neuroscience 2021Quote: ... and donor DNA plasmid containing a neomycin-resistance cassette (adapted from Addgene, PL552). Transfected cells were selected with neomycin for one week ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the sgRNA plasmid along with a plasmid containing Cas9 (pLX_311-Cas9, Addgene) were transfected into iPSCs using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid containing gRNA targeting AAVSI locus was obtained from Addgene (plasmid #41818). hiPS cells (2 × 106 cells ...
-
bioRxiv - Biophysics 2023Quote: DNA was synthesized from a Widom 601 sequence containing plasmid pGEMz_601 (Addgene, 26656) with primers containing a biotin and Cy3 ...
-
bioRxiv - Bioengineering 2023Quote: ... AAV9 vectors containing CMV-driven Cre plasmids were obtained from Addgene (pENN.AAV.CMVs.Pl.Cre.rBG #105537). Vectors were stored in a solution containing PBS and 0.001% Pluronic F-68.
-
bioRxiv - Molecular Biology 2023Quote: ... containing the AAVS1-T2 targeting guide and pSH-EFIRES-P-AtAFB2 (#129715, Addgene), which was digested using BglII [#R0144 ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...