Labshake search
Citations for Addgene :
401 - 450 of 1646 citations for Mouse Tryptophan 2 3 Dioxygenase TDO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777).
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pCMV4-3 HA/IkB-alpha was a gift from Warner Greene (Addgene, #21985). To generate firefly luciferase (Fluc)-expressing vector (pNL1.1.PGK[Fluc/PGK] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328), and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Genomics 2020Quote: ... We then selected then 3 sgRNAs to be cloned into lentiGuide-Puro (52963, Addgene) as previously described95 ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777). The oligos are listed in Table S3.
-
bioRxiv - Immunology 2022Quote: The genome-wide library Toronto KnockOut (TKO) CRISPR Library – Version 3 (TKOv3, #90294, Addgene) 39 ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...
-
bioRxiv - Microbiology 2022Quote: MacroH2A1 guide RNA (gRNA, see Table 3) was cloned into TLCv2 (Addgene plasmid: 87360), a plasmid encoding doxycycline-inducible Cas9-2A-GFP and gRNA expression ...
-
bioRxiv - Microbiology 2022Quote: ... PCMV4-3 HA/IκBα (SS32,36AA) was a gift from Warner Greene (Addgene plasmid #24143) and pLVX-EF1α-IRES-Puro was purchased from Clontech Laboratories (plasmid #631988).
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Genetics 2023Quote: ... 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454 ...