Labshake search
Citations for Addgene :
1 - 50 of 1413 citations for Mouse Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... elegans cDNA library into pACT2.2 (Addgene), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans expression [22] (obtained from Addgene). The spe-50 target sequence (5’-GATCTTGTTACAGTTCCAT-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... elegans codon-optimized tagBFP2 (pJJR81, Addgene #75029), an SL2 site ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2018) by replacing the ubi63E enhancer with the zfh1 enhancer (from pGL3_zfh1_CP-candidate_luc+; Addgene 86391) in between the KpnI (Thermo ...
-
bioRxiv - Neuroscience 2023Quote: ... the W3SL enhancer sequence was amplified from Addgene Plasmid #61463 with a 5’ XhoI site addition and subcloned into EcoRI and KpnI sites of Addgene Plasmid #61591 to replace bGHpA ...
-
bioRxiv - Microbiology 2020Quote: Plasmids for lentiviral transduction (pLJM1-2xStrep or untagged wild-type ORF68, mutants, and homologs) (Addgene #x-x) were generated by subcloning into the AgeI and EcoRI sites of pLJM1 modified to confer resistance to zeocin (Addgene #19319 ...
-
bioRxiv - Cell Biology 2022Quote: ... elegans cDNA and inserted into the T777T enhanced RNAi vector (Addgene cat # 113082). RNAi feeding vectors were freshly transformed into HT115 bacteria ...
-
bioRxiv - Genomics 2022Quote: ... for enhancer screening or CMV-Enh-Luc (Addgene #45968) for NREs screening (All tested sequences included in Supplemental Table 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: Reporters of enhancer activity were constructed by cloning mCerulean3 (Addgene #54730) into the multiple cloning site of Open Biosystems vector PB533A-2 ...
-
bioRxiv - Biochemistry 2022Quote: ... For experiments in Drosophila a pUAST-attB plasmid encoding drosophila Src homolog isoform A (Src42A) was cloned by amplifying Src42A codifying sequence from a pGEX-Src42A donor plasmid (Addgene #126673) using primers with EcoRI (forward 5′-CTGAATAGGGAATTGGGAATTCATGGGTAACTGCCTCACC-3′ ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Wnt-sensitive TOPFlash enhancer (PTCF/LEF) were purchased from Addgene (#89573 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x). Mutations in ORF68 (Addgene #x-x ...
-
bioRxiv - Molecular Biology 2022Quote: ... PT enhancer-tTA2 viruses were packaged as PHP.eB with vector from Addgene (#163480). Human READR and Reporter viruses were packaged as AAV2-Retro serotype ...
-
bioRxiv - Molecular Biology 2019Quote: In vivo enhancer testing was performed with the Stagia3 reporter vector (Addgene #28177)48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... VT enhancers were transferred from pCR8/GW/TOPO into pBPZpGal4DBDUw (Addgene clone 26233) using LR clonase technology (Invitrogen Gateway LR Clonase II Enzyme Mix - Catalog Number 11791-020).
-
bioRxiv - Immunology 2023Quote: ... Enhancer libraries were cloned into the lentiMPRA pLS-SceI vector (Addgene, Plasmid #137725) through Gibson assembly (E5510S ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus expressing tdTomato under the PVIN specific S5E2 enhancer (AAV9-S5E2-tdTomato, Addgene 135630-AAV9) was injected in mice using coordinates ...
-
bioRxiv - Developmental Biology 2023Quote: ... The enhancer was transferred into the destination vector pBPGAL4.2::VP16Uw (ref.60; Addgene, # 26228; RRID:Addgene_26228) via an LR clonase reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... The enhancer was transferred into the destination vector pBPGAL4.2::VP16Uw (ref.60; Addgene, # 26228; RRID:Addgene_26228) via an LR clonase reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The dpse enhancer and the CG13116 promoter were amplified from pAGW-dpse-GAL4-DBD (Addgene 125153) with primers including overhangs for Gibson cloning (Suppl ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
bioRxiv - Immunology 2023Quote: ... Each of four sgRNA sequences targeting the same enhancer was cloned into LentiCRISPRv2GFP (Addgene, Plasmid # 82416), LentiCRISPRv2-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CD68 promoter and enhancer (hCD68, ∼800 bp) was subcloned from pcDNA3-hCD68prm (Addgene #34837). The mouse F4/80 promoter (mF4/80 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The putative enhancer regions were cloned into the pE1b-GFP-Tol2-Gateway vector (Addgene, plasmid # 37846) [38] ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Cancer Biology 2020Quote: Multiple gRNAs per enhancer region were designed with CRISPR-SURF39 and cloned into lentiGUIDE-puro (Addgene #52963). All gRNA sequences are provided in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Molecular Biology 2019Quote: The reporter construct (traffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites; plasmid submitted to Addgene) was integrated into chromosomal location chr2L:9,094,918 ...
-
bioRxiv - Neuroscience 2021Quote: ... and inserted a strong CAG promoter (CMV immediate early enhancer/modified chicken β-actin promoter, from Addgene Plasmid #1378) in front of the FLEX-cassette to create pRMCE-CAG-Flex ...
-
bioRxiv - Neuroscience 2020Quote: ... The R58H05-AD and R46C03-DBD lines were generated by subcloning their respective enhancer regions into pBPp65ADZpUw (Addgene# 26234) or pBPZpGAL4DBDUw (Addgene# 26233) ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
bioRxiv - Genomics 2019Quote: ... These primers amplify both candidate enhancers and previously assigned degenerate barcodes and add homology arms to the ORI vector (Addgene 99296)25 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guide RNA sequences (Nes enhancer deletion-TTTGCGGTCTGAAAAGGATT, AGAATCGGCCTCCCTCTCCG, Nes null lines - GGAGCTCAATCGACGCCTGG, GCACAGGAGACCCTACTAAA) were annealed and ligated into px330 (Addgene, #42230) after digestion with BbsI (NEB ...