Labshake search
Citations for Addgene :
101 - 150 of 1191 citations for Mouse Liver Expressed Antimicrobial Peptide 2 LEAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774 ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Neuroscience 2023Quote: ... Projection mapping was performed with the membrane bound GFP expressed from AAV8-hSyn-JAWS-KGC-GFP-ER2 (Addgene 65014-AAV8). Calcium imaging experiments were performed with AAV1-Syn-FLEX-jGCaMP7f (Addgene 104492-AAV1 ...
-
bioRxiv - Genomics 2023Quote: ... pmCherry was a 4.7kb plasmid that expressed mCherry fluorescent protein under the control of a CMV promoter (Addgene, Cat# 632524). L1 plasmids consisted of pUBC-L1SM-UBC-EGFP and pMut2-UBC-L1SM-UBC-EGFP ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: OsKAI2 and the OsKAI2int mutant were independently cloned and expressed as GST (Glutathione-S-Transferase) fusion protein from the expression vector pCOOL (Addgene). BL21 (DE3 ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM DTT) to remove any unreacted dye and were incubated with 0.2 µM TEV protease (expressed from pRK793 (Addgene plasmid # 8827) and purified from E ...
-
bioRxiv - Systems Biology 2020Quote: ... expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe, Addgene plasmid #50916, RRID: Addgene_50916 41) expressed inactive version of Cas9 (dCas9 ...
-
bioRxiv - Systems Biology 2020Quote: ... expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe, Addgene plasmid #50916, RRID: Addgene_50916 41) expressed inactive version of Cas9 (dCas9 ...
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Bioengineering 2022Quote: The lentiviral transfer plasmid with constitutively expressed tetracycline transactivator (pEF1α-rtTA-Antares-WPRE) was constructed as follows: pNCS-Antares was obtained from Addgene (#74279) and P2A was added to the N-terminus of Antares with a primer overhang during PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... The N-terminal GFP-tagged Tlg2p was expressed as follows: the SacI and HindIII fragment (containing iGFP-TLG2) extracted from YLplac211-iGFP-TLG2 plasmid (Addgene #105262) was inserted into the SacI and EcoRV-digested pRS303 (pRS303-iGFP-Tlg2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... An AAV that only expressed the mCherry protein under the same neuronal promoter was use as control condition (Addgene Plasmid #114472). Wildtype and Cdr1as-KO neurons were infected at DIV4-6 by directly adding the viral particles into the culturing media at a titer of 109 VG/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... NIR-GECO2G was expressed via AAV2.1-CAG-NIR-GECO2G-WPRE (AAV generated by Yale Vision Core based on Addgene plasmid #159605). For positive control experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... we expressed GCaMP6s by direct microinjection of AAV2/1-hSyn-GCaMP6s-WPRE-SV40 (Addgene, 100843-AAV1, Titer: 2.5×1013 GC/mL) into the visual cortex ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Neuroscience 2023Quote: ... were expressed in Escherichia coli BL21 (DE3) (New England Biolab, Cat#C2530H) using the bacterial expression vector pGEX-KG myc (Addgene #209891). Following transformation ...
-
bioRxiv - Neuroscience 2024Quote: The Ca2+ indicator jRGECO1a (Dana et al., 2016) was expressed in IC neurons through induction with AAV vectors (Addgene #100854-AAV1), which were stereotaxically delivered as follows ...
-
bioRxiv - Developmental Biology 2019Quote: Two plasmids that express the needed gRNAs were made by inserting oligonucleotides (files S11) into the pCFD3-cU6:gRNA plasmid where they would be expressed from the pU6-3 promoter (Addgene plasmid #45946).
-
bioRxiv - Molecular Biology 2019Quote: ... All CBE constructs were cloned using the backbone of SQT817 and expressed under the control of a pCAG promoter (AgeI-NotI-EcoRV digest, Addgene ID 53373). For the P2A-EGFP fragments in these constructs ...
-
bioRxiv - Neuroscience 2021Quote: ... The annealed oligos were then cloned downstream of a constitutively expressed U6 promoter in a lentiviral vector (lentiGuide-Hygro-mTagBFP2, Addgene, cat.# 99374) using the golden gate cloning method (Bsmb1 ...
-
bioRxiv - Microbiology 2021Quote: ... FMNL3-V5 was expressed in U937 FMNL3 KO using lentiviruses generated in 293E cells co-transfected with the packaging constructs psPAX2 (Addgene plasmid 12260) and pCMV-VSV-G (Addgene plasmid 8454).
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2019Quote: ... either tdMCP-EGFP or mCherry was expressed from the phage-ubc-nls-ha-tdMCP-gfp plasmid (a gift from Robert Singer - Addgene plasmid # 40649) with mCherry incorporated digestion and ligation into XbaI and ClaI sites ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025; RRID:Addgene_19025; Kanai et al., 2000).
-
bioRxiv - Neuroscience 2019Quote: The AAV vector plasmid encoding SpCas945 (pX551) expressed from the MeCP2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Molecular Biology 2019Quote: The single vector rAAV-St1Cas9 LMD-9 systems containing liver-specific promoters were assembled from the above-described components into a derivative of pX602 (Ran et al., 2015) (Addgene plasmid #61593, a gift from Feng Zhang) containing a deletion within the backbone to eliminate BsmBI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2021Quote: ... SpCas9 and trans-activating CRISPR RNA (tracrRNA) were expressed using the pX459 plasmid (a gift from Dr. Feng Zhang, Addgene plasmid #62988,(Ran et al. 2013)) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Plant Biology 2020Quote: ... the Hip1 sequence was amplified without signal peptide and cloned into the pET28a (+) expression vector (Addgene, USA), eventually having a His-tag at the N-terminus ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...