Labshake search
Citations for Addgene :
301 - 350 of 1871 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: A plasmid expressing GST-Neh2Dual in bacteria under control of the T7 promoter was constructed by replacing vOTU from pOPINK-vOTU (Addgene plasmid # 61589 ...
-
bioRxiv - Bioengineering 2021Quote: AAV transduction of the genetically encoded GCaMP6s calcium reporter and mRuby control tag (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene) was performed at DIV1 as previously described50 ...
-
Peripheral CB1 receptor blockade acts as a memory enhancer through an adrenergic-dependent mechanismbioRxiv - Neuroscience 2021Quote: We used the following vectors: AAV-hM4Di-DREADD (AAV5-hSyn-hM4D(Gi)-mCherry) and AAV-control-DREADD (AAV5-hSyn-mCherry) from Addgene.
-
bioRxiv - Biochemistry 2020Quote: The plasmid encoding WT-α-syn was cloned into a pAAV vector under the control of a CMV promoter (Addgene plasmid #36055 ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp) (#17553, Addgene). Forty-eight hours after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... except that an additional lentivirus expressing eGFP under the control of a TET-responsive promoter was included (Addgene Cat # 30130). eGFP-positive neurons were mixed with eGFP-negative neurons in the 96-well plates ...
-
bioRxiv - Neuroscience 2022Quote: ... opsin construct), >1.3×1013 vector genomes/ml (Neuroscience Center Zurich, control construct) and 1.4 × 1013 GC/mL (Addgene, opsin construct). The viral vectors were aliquoted and stored at -80°C until stereotaxic injection surgeries.
-
bioRxiv - Cancer Biology 2022Quote: We cloned shRNAs against SCD and GPX4 as well as control shRNA in the Tet-pLKO-puro vector (Gift from Dmitri Wiederschain, Addgene plasmid #21915 ...
-
bioRxiv - Cell Biology 2022Quote: ... or pHAGE plasmids for overexpression of SOX15 or control mCherry were cotransfected with packaging vectors (psPAX2 and pMD2.G; Addgene) into 293T cells using PEI methods ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380, Addgene plasmid #36394 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Genomics 2019Quote: Melanoma cells and melanocyte growth assays were conducted using lentiviral transduction of MX2 cDNA under the control of tetracycline-inducible promoter using pINDUCER20 vector (Addgene). The MX2 cDNA clone (RC206437 ...
-
bioRxiv - Microbiology 2021Quote: ... Packaging 293T cells were transfected with targeted gene sgRNAs or negative control (non-targeting sgRNA-NC) and helper vectors (pMD2.G and psPAX2; gifts from Didier Trono; Addgene plasmid #s 12259 and 12260 ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... we used a commercially available AAV vector encoding the Ca2+ indicator GCaMP6s under the control of the CaMKIIa promoter (Addgene #107790 ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template encoding TIR1 under the control of the alpha tubulin promoter (pTUB1) and a CAT expression cassette was amplified from Addgene plasmid #87258 using oligos P1/P2 ...
-
bioRxiv - Genetics 2022Quote: Male adult Smg6flox/flox mice and their control littermates (Smg6+/+) received bilateral stereotactic injections of CMV.HI-Cre::eGFP AAV5 particles (AddGene, 105545) into the SCN (400 nl per site) ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... SNCA KD and control plasmids (Zharikov et al., 2015), and Mito-PAGFP plasmid (Karbowski et al., 2004) were purchased from Addgene (plasmids 85131 ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Microbiology 2023Quote: ... ANP32B or a non-targeting control gRNA as well as with the packaging plasmids pMD2.G and psPAX2 (gifts from Didier Trono, Addgene plasmids # 12259 and # 12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting XRN1 sg1 and sg2-resistant XRN1 constructs and a GFP control construct were sub-cloned into the pLEX307 lentiviral expression vector (Addgene) under the control of an EF-1α promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received bilateral infusion an AAV encoding the inhibitory opsin Arch (AAVDJ-Syn-eArch-eYFP, Stanford Vector Core) or fluorophore control (AAV8-Syn-GFP; Addgene) into the CeA (0.1-0.2 µl) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The UNK-targeting or non-targeting control guide sequences were introduced into the BsmBI-digested lentiCRISPR v2-Blast plasmid (Addgene_83480) as pairs of annealed oligos62.
-
bioRxiv - Neuroscience 2023Quote: ... mice received bilateral infusion of an AAV encoding the inhibitory opsin archaerhodopsin (AAVDJ-Syn-eArch-eYFP, Stanford Vector Core) or fluorophore control (AAV8-Syn-GFP; Addgene) into the BLA (0.1 - 0.2 µl) ...
-
bioRxiv - Genomics 2023Quote: ... pmCherry was a 4.7kb plasmid that expressed mCherry fluorescent protein under the control of a CMV promoter (Addgene, Cat# 632524). L1 plasmids consisted of pUBC-L1SM-UBC-EGFP and pMut2-UBC-L1SM-UBC-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Neuroscience 2023Quote: The control vector expressing eYFP in the Cre-dependent and Flp-dependent manner was a gift from Karl Deisseroth (Addgene plasmid # 55650 ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Plant Biology 2019Quote: ... containing a human codon optimized allele of Cas9 under the control of the AtRPS5a promoter and the Pisum sativum rbcS E9 terminator (Addgene: 117505) was assembled with a FAST-Red selectable marker (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Casper strains were available and 20 ng/μL DNA plasmids encoding mNG-GECO1 under the control of nuclear-localized elavl3/HuC promoter (Addgene: 59530) were injected into two-cell stage embryos of Casper mutant zebrafish33 with 40 ng/μl Tol2 transposase mRNA (26 ...
-
bioRxiv - Genetics 2019Quote: ... A single stranded rAAV vector expressing Firefly luciferase (FLuc) under control of the CAG promoter (pAAV-CAG-FLuc, Addgene, Cat#83281) was generated by replacing the GFP sequences in plasmid pAAV-CAG-GFP with Firefly luciferase sequences obtained from plasmid pAAV-EF1α-FLuc-WPRE-HGHpA (Addgene ...
-
bioRxiv - Microbiology 2019Quote: Single oligonucleotide guides for three scramble controls and two exons in Tax1bp1 selected from the Brie library were closed into lentiGuide puro (Addgene #52963) using the following primer pairs ...
-
bioRxiv - Cancer Biology 2021Quote: The control and LKB1-KO lines were generated by infecting the cell lines with lentivirus generated from the LentiCRISPRv2 plasmid (Addgene: 52961). The control and TPI1-KO or SIK-KO lines were generated by infecting the Cas9-expressing lines (LentiCRISPRv2 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Genomics 2022Quote: AAV coding STAT5bCA and Luciferase (control) was prepared and quantified by triple transfection of HEK293FT cells using methods adapted from protocols provided by Addgene (www.addgene.org). HEK293FT is a fast growing and highly transfectable derivative (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRen targeting Renilla luciferase cDNA was used as negative-control sgRNA (GGTATAATACACCGCGCTAC)33 and cloned into lenti sgRNA(MS2)-zeo backbone (Addgene: 61427) or lenti sgRNA(MS2)-zeo-IRES-eGFP backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA), All animals received three viral injections in the anterior cingulate cortex in each hemisphere as follows (skull at +5.0mm to horizontal plane) ...
-
bioRxiv - Neuroscience 2020Quote: ... and the control group (n = 10) received injections of AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA). The injection coordinates and volumes for the three injections made into the anterior cingulate cortex were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Immunology 2021Quote: ... LentiGuide-Puro empty vector (control) or SP140 gRNA cloned plasmids were then co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260 ...