Labshake search
Citations for Addgene :
301 - 350 of 801 citations for Mouse Hepatocellular carcinoma associated protein TD26 homolog ANGPTL8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... A cDNA for GFP-tagged mouse septin 6 was obtained from Addgene (plasmid #38296) and cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... including existing parts (Addgene Kit # 1000000080) and custom-made parts (Table 2) ...
-
bioRxiv - Neuroscience 2019Quote: Mouse Rit2 (mRit2) cloned into pGEX2T was a gift from Julian Downward (Addgene plasmid #55663)[59] ...
-
bioRxiv - Cancer Biology 2019Quote: SgRNAs targeting mouse Wnt5a or Yap1 were cloned into pSpCas9(BB)-2A-Puro (Addgene, #62988) and transfected into target cells ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid for inserting transgene into mouse genome: pBT378_pattB-pCA-GFP-pA-attB plasmid (Addgene, 52554).
-
bioRxiv - Cancer Biology 2023Quote: ... GSDME-EGFP or mouse Mlh1 lentiviral vector and packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding EGFP-LC3 fusion protein was released from pBABE-EGFP-LC3-puro (Addgene, #22405) and cloned into pQCXIN-EGFP-N1-Neo by the 5’-EcoRI and 3’-AgeI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...