Labshake search
Citations for Addgene :
501 - 550 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Two plasmids (based on the gRNA expression plasmid Addgene #49330) encoding Cas9 as well as guide RNAs targeting the integration site were kindly received from the Brennecke Lab at IMBA Vienna (Batki et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR–Cas9 plasmid was generated using PX458 (Addgene plasmid #48138) and sgRNA targeting N-terminal of YTHDC1 near ATG start codon ...
-
bioRxiv - Microbiology 2022Quote: ... Two different plasmids pENO1-iRFP-NATr (Plasmid #129731, Addgene Inc) and pFA-GFP-HIS1 were used to design the repair segments ...
-
bioRxiv - Neuroscience 2022Quote: ... or pCMV-Cre-GFP plasmid (“Cre Shine” plasmid, Addgene, 37404) were added to 2.5% LipofectamineTM-2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: The myc-CIITA plasmid was obtained from Addgene (Plasmid #14650). The myc-PK plasmid was a gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... 6.5 µg envelope plasmid pCMV-VSV-G (Addgene, Plasmid #8454) and 5 µg packaging plasmid pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... pTK14-GFP-LGN plasmid was obtained from Addgene (Plasmid #37360). pTK-GFP was cloned as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... The CIBN-CAAX plasmid was obtained from Addgene (Plasmid #79574) and cloned into the pLVX-puro vector ...
-
bioRxiv - Genomics 2022Quote: ... Viral plasmids were obtained from Addgene (plasmids #19780, 52047, 30130). FUdeltaGW-rtTA was a gift from Konrad Hochedlinger (Addgene plasmid # 19780) ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmid pDONR223_NOTCH1_ICN (Addgene plasmid #82087; http://n2t.net/addgene:82087; RRID:Addgene_82087), plasmid GPCR-TANGO and HTLA cells were a gift from the lab of Richard Axel ...
-
bioRxiv - Microbiology 2023Quote: ... or myristylated-Akt (myr-Akt) plasmid (Addgene plasmid # 26453 (64)) ...
-
bioRxiv - Bioengineering 2023Quote: ... pegRNA plasmids were constructed by using the plasmid (Addgene #132778) as PCR template with the forward primers (containing spacers ...
-
bioRxiv - Bioengineering 2022Quote: An Arc plasmid (pGEX-6p1-GST-ArcFL, Addgene plasmid #119877) and a GFP plasmid (pcDNA3-EGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Viral plasmids were obtained from Addgene (plasmids #19780, 52047, 30130). FUdeltaGW-rtTA was a gift from Konrad Hochedlinger (Addgene plasmid # 19780) ...
-
bioRxiv - Genomics 2023Quote: The KRAS expression plasmid was obtained from Addgene (Plasmid #111849) as an E ...
-
bioRxiv - Cell Biology 2023Quote: ... 6.5 μg envelope plasmid pCMV-VSV-G (Addgene, Plasmid #8454). Virus particles were collected 48 h after transfection then filtered through a 0.45 μm syringe filter and used to infect MCF-10A cells in the presence of 8 μg/ml polybrene (Sigma) ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasmid vectors p415-GalL-Cas9- CYC1t (Addgene plasmid # 43804) and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene plasmid # 43803 ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3-Myc-ASC plasmid encoding human ASC (Addgene plasmid # 73952) were gifts from Christian Stehlik62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the VSC-G envelope expressing plasmid (Addgene Inc., Plasmid 12259), in addition to the plasmid pLVX-UbC-rtTA-Ngn2:2A:EGFP (Addgene Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... coli with lambda phosphatase spectinomycin-resistant plasmid (Addgene plasmid #79748). We used either wild-type ...
-
bioRxiv - Synthetic Biology 2023Quote: The AsLOV2 plasmid was acquired from Addgene (Addgene plasmid #80406). The LOV2 mutant and DD sequences were obtained as g-Blocks from IDT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the pCutamp plasmid (gift from Sheng Yang (Addgene plasmid # 140632)38 ...
-
bioRxiv - Genetics 2023Quote: His-SIRT5 expression plasmid was obtained from Addgene (plasmid #25487). Site-directed mutagenesis of WT SIRT5 was performed using the QuickChange Lightning site-directed mutagenesis kit (#210518 ...
-
bioRxiv - Microbiology 2024Quote: ... and the FLP recombinase expression plasmid (pFLP3, Addgene plasmid # 64946) were gifts from Herbert Schweizer [38].
-
bioRxiv - Molecular Biology 2024Quote: ... as well as the plasmid F11R pEBio (Addgene plasmid #61486) used for further cloning were a gift from Gavin Wright (60 ...
-
bioRxiv - Immunology 2024Quote: ... using the SARS-CoV1 SPIKE plasmid pcDNA3.3_CoV1_D28 (Addgene plasmid # 170447)39 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Cancer Biology 2024Quote: ... lentiGuide-PURO plasmid (gift from Feng Zhang; Addgene plasmid # 52963) via Gibson Assembly (New England BioLabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... The segment containing RFP and shRNA was next sub-cloned to replace CaMP3.0 in AAV-CMV-LOX-STOP-LOX-mG-CaMP3.0 vector (Addgene, #50022) by using Asc I ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA oligonucleotides directed against the indicated genes were annealed and cloned into Tet-pLKO-puro lentiviral vector (Addgene #21915) digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Biophysics 2021Quote: ... HeLa cells were stably engineered to display a doxycycline-inducible GFP fused to a mouse CD80 transmembrane domain using standard second-generation lentivector production protocols and the plasmids pMD2G (Addgene 12259), pCMVR8.74 (Addgene 22036) ...
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Developmental Biology 2023Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Cell Biology 2020Quote: ... (Addgene plasmid #29573), and pEYFP-Cdc42 from Joel Swanson (Hoppe and Swanson ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Molecular Biology 2021Quote: ... (Addgene plasmid # 33239).
-
bioRxiv - Biophysics 2021Quote: ... (Addgene plasmid #32751) and the pBa.TfR.GFP vector was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 4506) ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids from Addgene were grown from single clones which were sequence verified ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid expressing GFP-Lman1 was obtained from Addgene (Addgene plasmid 166942) (68).
-
bioRxiv - Microbiology 2021Quote: ... cloned into pLB vector from Addgene (Addgene plasmid 11619) as previously described (96) ...