Labshake search
Citations for Addgene :
651 - 700 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... An S288C nup116ΔGLFG strain was generated by cloning the nup116ΔGLFG genome sequence from SWY2791 into SnaBI- and XhoI-digested pAG306-GPD-empty chr I (Addgene 41895) using Gibson Assembly master mix (NEB E2611L) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with an I-SceI rare cutter endonuclease coding plasmid construct (cat #26477, Addgene Watertown, Massachusetts, USA). After 96 h of gene silencing ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Biophysics 2021Quote: The plasmid containing yeast (Saccharomyces cerevisiae) Ubr1 was purchased from Addgene (plasmid # 24506) 41 ...
-
bioRxiv - Genomics 2019Quote: The expression vector containing the PA-Tnp fusion construct is available from Addgene under accession number 121137 ...
-
bioRxiv - Developmental Biology 2019Quote: The lentiCRISPRv2-mCherry plasmid containing cas9 and Cherry fragments was purchased from Addgene (#99154 ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the gene of interest containing pLJM1 lentiviral packaging plasmids (Addgene, catalog #91980) at concentrations of 1.3 pmol ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... was inserted into a vector PX601-containing wild-type SaCas9 (Addgene plasmid #61591) and replacing that domain of SaCas9 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Genetics 2019Quote: ... The plasmid containing Enhanced SpCas9 (version 1.1, Addgene #71814, Slaymaker et al., 2016) was a generous gift of Carine Giovannangeli from the Museum National d’Histoire Naturelle ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The fragment containing the LbCpf1 coding sequence was amplified from pY016 hLbCpf1 (Addgene plasmid # 69988 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids containing coding regions for the FPs mKate (mKate-H4-23, Addgene 56061), mRUBY (GCaMP6f-mRUBY ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Neuroscience 2021Quote: ... and donor DNA plasmid containing a neomycin-resistance cassette (adapted from Addgene, PL552). Transfected cells were selected with neomycin for one week ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the sgRNA plasmid along with a plasmid containing Cas9 (pLX_311-Cas9, Addgene) were transfected into iPSCs using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid containing gRNA targeting AAVSI locus was obtained from Addgene (plasmid #41818). hiPS cells (2 × 106 cells ...
-
bioRxiv - Biophysics 2023Quote: DNA was synthesized from a Widom 601 sequence containing plasmid pGEMz_601 (Addgene, 26656) with primers containing a biotin and Cy3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing the AAVS1-T2 targeting guide and pSH-EFIRES-P-AtAFB2 (#129715, Addgene), which was digested using BglII [#R0144 ...
-
bioRxiv - Bioengineering 2023Quote: ... AAV9 vectors containing CMV-driven Cre plasmids were obtained from Addgene (pENN.AAV.CMVs.Pl.Cre.rBG #105537). Vectors were stored in a solution containing PBS and 0.001% Pluronic F-68.
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: A lentiviral plasmid containing a dCAS9/KRAB/MeCP2 cassette was obtained from Addgene. Lenti-X 293T cells were transfected using this plasmid and virus containing the plasmid was generated and appropriate titers were determined ...
-
bioRxiv - Genetics 2023Quote: We used the 3XFLAG-VP64-SadCas9-NLS-VP64-containing plasmid (Addgene cat # 135338), in which each sgRNA was annealed and inserted by BsaI directional cloning as described previously31 ...
-
bioRxiv - Neuroscience 2023Quote: ... adeno-associated virus containing GCaMP7f (AAV1-hSyn-jGCaMP7f, AddGene viral prep #104488-AAV1) and a second virus encoding the static red indicator mCherry (AAVDJ-hSyn-mCherry ...
-
bioRxiv - Cancer Biology 2024Quote: Oligos containing sequences for sgRNAs (Table S5) were cloned into pLentiGuide construct (RRID:Addgene_46911)21 ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...