Labshake search
Citations for Addgene :
351 - 400 of 10000+ citations for Mouse CSRNP1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid K8.1 Pr pGL4.16+Ori (Addgene plasmid #131038) contains the left origin of replication along with a 100 bp fragment of the K8.1 promoter and has been described previously (1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids pcDNA4/TO-ORF18-2xStrep (Addgene plasmid # 120372), pcDNA4/TO-ORF24-2xStrep (Addgene plasmid #129742) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and the envelope plasmid VSVG (Addgene, Plasmid#12259) in the presence of Lipofectamine 2000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... The virus package plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2 sgRNA plasmid or Cas9Bsd plasmid (Addgene #68343) (45 ...
-
bioRxiv - Immunology 2021Quote: ... and pMD2.G envelope plasmid (Addgene plasmid #12259). Viral supernatant was collected and concentrated using Lenti-X Concentrator 24- and 48-hours after the transfection (Clontech) ...
-
bioRxiv - Genetics 2019Quote: ... plasmid pAC154-dual-dCas9VP160-sgExpression (Addgene plasmid # 48240)18 was linearized to introduce the 2A-GFP sequence downstream to the dCas9-VP160 fusion ...
-
bioRxiv - Immunology 2021Quote: ... epidermidis: sGFP expressing plasmid (pTH100-Addgene plasmid #84458)52 was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 ng Cas9 expression plasmid (Addgene plasmid #43945), and 200 ng of pMaxGFP via nucleofection (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... 100 ng of plasmid plRL19 (Addgene plasmid #163634) was also added ...
-
bioRxiv - Microbiology 2022Quote: ... The packaging plasmids pMD2.G (Addgene plasmid 12259) and psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Bioengineering 2022Quote: ... and regulatory plasmids pRSV-Rev (Addgene plasmid # 12253) were a gift from Didier Trono[34] ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope plasmid PmD2.G (Addgene Plasmid #12259), and lentiviral construct and added dropwise to the dish ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... plasmid pAAV-hSyn-DIO-GCaMP6s (Addgene plasmid 184284) was generated by inserting the GCaMP6s open reading frame from pGP-CMV-GCaMP6s (Addgene plasmid 40753 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pMD2.G (envelope plasmid, Addgene, Plasmid #12259) were diluted in 250 µL Opti-MEM (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... an adenovirus helper plasmid (pAdΔF6; Addgene plasmid 112867), and an ITR-flanked AAV transgene expression plasmid AAV-CAG-eGFP (provided by Dr ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid pEcCas contains kanamycin resistance (Addgene Plasmid #73227) and plasmid pEcgRNA (Addgene Plasmid #166581 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5μg pMD2.G envelope plasmid (plasmid #12259, Addgene) and with 15 μg mScarlet-cenexin plasmid (Twist BioScience) ...
-
bioRxiv - Microbiology 2024Quote: ... Tn7 transposase expression plasmid (pTNS, Addgene plasmid # 64967), and the FLP recombinase expression plasmid (pFLP3 ...
-
bioRxiv - Microbiology 2024Quote: ... obtained from the pAG25 plasmid (Addgene plasmid #35121), flanked with sequences of the target allele ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with packaging plasmids psPAX2 (Addgene plasmid #12260) and envelope plasmid pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and envelope plasmid pMD2.G (Addgene plasmid #12259), generously provided by the Trono lab ...
-
bioRxiv - Microbiology 2024Quote: ... The reporter plasmids 4xCSL-luciferase (Addgene plasmid #41726) and 4xCBS-luciferase encode firefly luciferase under the control of four RBP-Jk binding sites are were gifts of Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Microbiology 2020Quote: The mouse cDNA sequence of filamin A from MEF cells was amplified and cloned into pcDNA3-myc plasmid (Addgene). The resulting plasmid pcDNA3- myc-FLNA was transiently transfected in the MEF cells and then the transfected cells were infected with Toxoplasma for 18 h (MOI ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse Sp7 and GFP lentiviruses were generated by transfecting HEK293T cells with a blasticidin resistance backbone (Addgene, plasmid 26655) along with psPAX2 and MD2.G ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Pathology 2022Quote: ... tdTomato-WPRE-polyA sequence was obtained from the sequence of the targeting vector for Ai9 mouse (Addgene plasmid #22799) since the Ai9 mouse shares the same sequence for tdTomato-WPRE-polyA with the Ai14 mouse used in this study29 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865; http://n2t.net/addgene:108865; RRID:Addgene_108865).
-
bioRxiv - Cancer Biology 2019Quote: ... and the individual CRISPR components (Cas9 expressing plasmid or sgRNA expressing plasmid: MCB306, Addgene Plasmid #89360 or MCB320, Addgene Plasmid #89359). Lentivirus-laden supernatant was harvested at 48 and 72 hrs after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral plasmids included the packaging plasmid psPAX2 (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260) and the envelope plasmid pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviral transfer plasmid plus packaging plasmids psPAX2 (gift from Didier Trono, Addgene Plasmid #12260, RRID:Addgene_12260) and pCMV-VSV-G (gift from Bob Weinberg ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviral transfer plasmid plus packaging plasmids psPAX2 (gift from Didier Trono, Addgene Plasmid #12260, RRID:Addgene_12260) and pCMV-VSV-G (gift from Bob Weinberg ...
-
bioRxiv - Molecular Biology 2023Quote: pcDNA-dCas9-p300 Core plasmids (D1399Y; plasmid #61358 and plasmid #61357) were purchased from Addgene. pSPgRNA (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... were transfected with the transfer plasmid and the packaging plasmids (Addgene plasmids #12263 and #8454) using TransIT-LT1 transfection reagent (Mirus MIR 2304) ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were transfected with transfer plasmid and two helper plasmids psPAX2 (Addgene plasmid #12260) and VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 uL of serum-free media was added to 200 ng of plasmid DNA (100 ng CAG-nanobody-TagBFP plasmid and 100 ng CAG-dsRed plasmid (Addgene plasmid 11151) (Matsuda and Cepko ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Knockdown experiments with shRNA lentiviruses were conducted according to the standard lentivirus package and transduction protocols from Addgene. These pLKO-based lentiviral shRNA plasmids were co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA sequences containing the following target sequences were cloned into the pLKO.1-TRC cloning vector (Addgene, 10878): nontargeting (NT) ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA sequence of p21 (shp21.1:TRCN0000287021, shp21.2:TRCN0000040126) were cloned into lentiviral vector pLKO.1 neo (Addgene#13425) or pLKO.1 mCherry-Puro generated by overlapping PCR using primer pairs (Table S1 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral doxycycline-inducible shRNAs (targeting DDX46 and HTATSF1) were prepared in the Tet-pLKO-puro backbone (Addgene # 21915) by cloning the gene-targeting annealed oligos also identified from the above url into the AgeI - EcoR1 sites (details in TableS5) ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs with sequences listed in Table S3 were cloned into tet-inducible vector Tet-pLKO-puro (Addgene #21915). To generate luciferase reporters ...