Labshake search
Citations for Addgene :
401 - 450 of 656 citations for Mouse Anti Zika Virus NS1 Antibody B4 Biotin Conjugate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2VP16 was generated by fusing the open reading frame for the herpes simplex virus-1 (HSV-1) VP16 (amplified from pActPL-VP16AD plasmid, Addgene plasmid #15305, Watertown, USA) activation domain to Err2 ...
-
bioRxiv - Neuroscience 2023Quote: We performed an initial calibrating analysis on Emx-Cre mice (see Animals) expressing Cre-dependent GFP virus (Addgene pCAG-FLEX-EGFP-WPRE; #51502-AAV9) following a dot-wise application of 1:2000 diluted virus (see Organotypic Slice Culture methods) ...
-
bioRxiv - Bioengineering 2023Quote: ... was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1, http://n2t.net/addgene:51085, RRID:Addgene 51085, a gift from Jonathan Ting) diluted 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Each mouse received bilateral injections (15 nl/ hemisphere at a rate of 15 nl/min) of either excitatory DREADD virus pAAV-CaMKIIa-hM3D(Gq)-mCherry (Addgene Cat# 50476-AAV5, titer: 1.7x1013) or control virus pAAV-CaMKIIa-EGFP (Addgene Cat# 50469-AAV5 ...
-
bioRxiv - Systems Biology 2020Quote: ... we indirectly titered each experimental replicate’s batch of virus by co-transducing parallel samples of HCFs with pMXs-DsRed Express (Addgene 22724; a gift from Shinya Yamanaka) and pMXs-TurboGFP (see “Cloning” above ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857; http://n2t.net/addgene:20857; RRID:Addgene_20857, Howarth et al., 2005).
-
bioRxiv - Molecular Biology 2023Quote: ... were fluorescently tagged in two steps by first cloning the ORFs into plasmid H6-mOrange (pET Biotin His6 mOrange LIC cloning vector, Addgene plasmid #29723) and then into plasmid 438B.
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids expressing murine PKA (mPKA) RIIα and ER membrane targeting signal fused miniTurbo promiscuous biotin ligase (ER-mTb) were obtained from Addgene (#45527 and #107174, respectively). The mPKA RIIα sequence was PCR amplified and cloned into the upstream of the mTb sequence ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...