Labshake search
Citations for Addgene :
1 - 50 of 253 citations for Mouse Anti Staphylococcus Aureus Enterotoxin A Antibody H10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Aureus dCas9 (gift from Feng Zhang, Addgene plasmid no. 61594) constructs and the VPR effector were driven by a PGK promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... aureus with improved activity (eSrtA) was obtained from Addgene (plasmid #75144) and expressed in LB medium at 18°C for 16 hours (Chen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... aureus Cas9 was amplified from a vector courtesy of Feng Zhang (Addgene #61591). Q5 site directed mutagenesis (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...