Labshake search
Citations for Addgene :
451 - 500 of 979 citations for Mouse Anti Hepatitis C Virus NS4b Antibody 1858 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Molecular Biology 2019Quote: ... HsScc1 was cloned into a 438-C vector (Addgene, 55220), containing an N-terminal His-tag followed by a maltose binding protein (MBP ...
-
bioRxiv - Cancer Biology 2021Quote: ... VRK1WT was further cloned into PLX305(C-TAG) (Addgene #91798) and VRK1WT ...
-
bioRxiv - Cancer Biology 2022Quote: ... into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene). To generate the WILD-seq library ...
-
bioRxiv - Molecular Biology 2023Quote: ... C-terminally AcGFP-tagged SOD1 variants SOD1-WT (Addgene: #264074) and SOD1-G85R (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-ARP2-C-14 (gift from Michael Davidson, Addgene plasmid # 53992); MICAL-L1 (Origene ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-Fascin-C-10 (gift from Michael Davidson, Addgene plasmid # 54094); pARF6(Q67L)-CFP (gift from Joel Swanson ...
-
bioRxiv - Molecular Biology 2019Quote: ... FKH2 was entirely replaced with URA3 (C. albicans) using pAG61 (Addgene), and the resulting strain was transformed with fkh2-dsm DNA from p405-fkh2-dsm (Ostrow et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-LaminA-C-18 was a gift from Michael Davidson (Addgene plasmid # 55068 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal Flag-tagged pCAGGS-SARS2-S-D614 (Addgene plasmid #156420) and pCAGGS-SARS2-S-G614 (Addgene plasmid #156421 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Immunology 2020Quote: mApple-Dectin1A-C-10 was a gift from Michael Davidson (Addgene plasmid # 54883 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-MAP4-C-1069 was a gift from Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-MAP4-C-10 (a gift from Dr. Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and C-FLAG-D20 or EGFP (pEGFP-N1-FLAG, Addgene 60360) chimeras were also subcloned into the XhoI and MfeI linearized attb-BSDr vector using the NEBuilder HiFi Assembly Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCDH-Flag-c-MYC was a gift from Hening Lin (Addgene plasmid # 102626 ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted into the pScarlessHD-C-3xVHH05-DsRed (Addgene, Plasmid #171580) (63 ...
-
bioRxiv - Plant Biology 2023Quote: ... The B- and C-modules with mTurquoise2 (amplified from an AddGene-derived template (Goedhart et al. ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cell Biology 2024Quote: ... were cloned into the plasmid TVBB C-term-mScarlet (Addgene 169219) with the purpose of knocking in mScarlet in frame with D882 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HAMECs were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 8µg of plasmid was used per 1 million cells using nucleofection.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 5µg per 10cm dish or 0.5µg per well of a 6-well dish ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: Addgene plasmids used were: pCMV-lyso-pHluorin (RRID:Addgene_70113, gift from C. Rosenmund28), pLAMP1-mCherry (RRID:Addgene_45147 ...
-
bioRxiv - Biophysics 2019Quote: ... pGFP-Cytochrome C was a gift from Douglas Green (Addgene plasmid # 41181). GPI-mNeonGreen was created by replacing GFP with mNeonGreen ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132; http://n2t.net/addgene:54132; RRID:Addgene_54132) and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Cell Biology 2022Quote: mEmerald-Zyxin-C-14 construct (Addgene # 54318; a gift from Michael Davidson) was cloned into the lentiviral vector pLL5.0 (Vitriol et al. ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Plant Biology 2022Quote: ... StTGA2.3 was fused with a C-terminal mTagBFP2 (from Addgene plasmid # 102638)74 blue fluorescent protein (BFP ...
-
bioRxiv - Systems Biology 2022Quote: ... the PINK1 insert was derived from pCMVTNT-PINK1-C-Myc (Addgene, #13314) and the mNeonGreen insert was obtained as cDNA (Allele Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Neuroscience 2023Quote: ... C-terminally GFP-tagged Mannosidase cDNA was obtained from Addgene (plasmid #160905) and used without additional subcloning ...
-
bioRxiv - Cell Biology 2023Quote: ... hNHE1-HA (3X on c-terminal) (pYN4+, #78715) was originally from Addgene with D720G mutation ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.