Labshake search
Citations for Addgene :
601 - 650 of 1249 citations for Mouse Anti Hepatitis B Virus X Protein Antibody 1884 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Neuroscience 2022Quote: ... 350nl of retrograde Cre (AAVrg-hSyn-Cre-EGFP, titer 1.3 x 1013, Addgene 105540-AAVrg, lot v38984) was injected bilaterally into GPe (AP ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig. 5A; UNC Vector Core; 3.9 x 1012; Addgene plasmid #52473); AAV2-retro-CMV-EGFP (Suppl ...
-
bioRxiv - Neuroscience 2023Quote: ... or rAAV5-hsyn-DIO-mCherry (around 5.0 x 1012 vg/ml for each) (Addgene, Watertown, MA, USA) in the dorsal raphe nucleus [Anterior-posterior (AP) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 150-250 nL of AAV5-EF1α-DIO-hChR2(H134R)-mCherry (5.25 x 1012 GC/ml, RRID:Addgene_20297), AAV5-EF1α-DIO-mCherry (7.3 x 1012 GC/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... A control vector lacking the hM4Di receptor was also used (AAV8-CaMKII-EGFP; 2.1 x 1013 gc/ml Addgene viral prep # 50469-AAV8; http://n2t.net/addgene:50469; RRID:Addgene_50469 ...
-
bioRxiv - Neuroscience 2023Quote: ... a kind gift from Don Arnold) and pENN.AAV.CamKII 0.4.Cre.SV40 (viral titer/ml: 2.3 x 10^13 GC/ml (Addgene 105558-AAV9) in the ratio 2:1:1 ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-CAGGS-DIO-H2B-GFP-P2A-N2cG (Fig. 5C; Salk Vector Core; 2.5 x 1012; Addgene plasmid #73475). The following rabies viruses were used ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Biophysics 2022Quote: ... the OCP-pET28 plasmid was co-expressed with pAC-CANTHipi plasmid (gift from Francis X Cunningham Jr, Addgene plasmid # 53301 ...
-
bioRxiv - Biophysics 2022Quote: ... the OCP-pET28 plasmid was co-expressed with pAC-CANTHipi plasmid (gift from Francis X Cunningham Jr, Addgene plasmid # 53301; http://n2t.net/addgene:53301; RRID:Addgene_53301). The transformed cells were then grown in the presence of kanamycin (25 μM/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral vector stocks were obtained by transfection of 6.5 x 106 HEK293T cells with packaging vector gag-pol-rev (pCMV-dR8.74, #22036, Addgene), a vesicular stomatitis virus G (VSV-G ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following adeno-associated viruses (AAVs): AAV5-hSyn-mCherry (2.3 x 1013 vg/mL, Addgene #114472), AAV5-hSyn-hM4D(Gi)-mCherry (8.6 x 1012 vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Neuroscience 2023Quote: ... a volume of 800 nL of AAV5-CAG-dLight1.3b-GFP (titer 1.03 x 1013 viral particles/ mL; Addgene) was infused per site at a rate of 100 nL/ min through a 31-G ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAVretro-Cre (pAAV-Ef1a-mCherry-IRES-Cre, 55632-AAVrg, 1.1-3.5 x 1012 viral genomes/ml, Addgene) into the ipsilateral posterior medial nucleus of the thalamus (POM) ...
-
bioRxiv - Neuroscience 2024Quote: ... University of Pennsylvania vector core) and AAV1-Syn-Flex-GCaMP6f-WPRE-SV40 (0.4 μl, 1.3 x 1013 GC/ml, Addgene) was injected into the IL ...
-
bioRxiv - Neuroscience 2024Quote: ... we intracranially injected 350 nL of AAVrg-hSyn-EGFP (Addgene 50465-AAVrg; titer: 2.4 x 1012 vg/mL) into the right NAcSh at coordinates AP ...
-
bioRxiv - Neuroscience 2024Quote: ... we intracranially injected 350 nL of AAVrg-hSyn-mCherry (Addgene 114472-AAVrg; titer: 2.4 x 1012 vg/mL) at coordinates AP ...
-
bioRxiv - Neuroscience 2023Quote: ... the AAV used was AAV9-EF1A-DIO-hChR2(E123T/T159C)-eYFP (300nl/hemisphere, titer:8.96 x 1013, Addgene). For DREADDs stimulation epxperiments ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.