Labshake search
Citations for Addgene :
151 - 200 of 920 citations for Mouse Anti Hepatitis B Virus Core Antibody M412 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... titer: 4.5 × 1013 GC/ml (Cat # AV-1-ALL864, RRID:Addgene_51503; U Penn Vector Core).
-
bioRxiv - Neuroscience 2023Quote: ... Viral vector sequences are available through commercial suppliers (e.g., Addgene and UNC Vector Core).
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core; Addgene 169128) or AAV9-Ef1a-DIO-mCherry (UNC Vector core ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core; Addgene 169128), and AAV2/1-hSyn-DIO-GreenDownwardcADDis (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core; Addgene 169128) or AAV9-Ef1a-DIO-mCherry (UNC Vector core ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core; Addgene 169128) and AAV1-Syn-Flex-GCaMP6s-WPRE-SV40 (Addgene 100845-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-Syn-Flex-GCaMP6S-WPRE-SV40 (0.3 μl, #100845-AAV1, Penn vector core/Addgene) was injected into LC (AP −5.3 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Cancer Biology 2019Quote: Virus rich media (VRM) of the Cas9-Blast plasmid (Addgene: #52962) was infected into regular AML lines using the standard lentivirus infection protocol described below ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudotyped rabies virus (SAD B19 strain, EnvA-RbV-GFP, Addgene# 52487) was commercially obtained from the Janelia Viral Tools Facility stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... or a control virus (AAV5-hSyn-DIO-EGFP; Addgene, 50457-AAV5) targeting the CeA ...
-
bioRxiv - Neuroscience 2022Quote: ... GCaMP6s virus (AAV-DJ-Ef1a-DIO-GCaMP6s) was obtained from Addgene, Tet-tox virus (AAV-CBA-DIO-GFP-TetTox-WPRE-bHGpA ...
-
bioRxiv - Neuroscience 2020Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 virus (titer: 2.2 × 1013 GC/mL, obtained from AddGene, USA) was injected into dorsal hippocampus (AP -2.1 ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 μL AAV pCAG-FLEX-EGFP-WPRE virus (Addgene, Cambridge, MA) was injected into the NTS ...
-
bioRxiv - Immunology 2020Quote: ... and a murine leukemia virus (MLV) Gag-Pol plasmid (Addgene # 14887) were purified using the Endo-Free Plasmid Maxi Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV-hSyn-DIO-GCaMP7f-WPRE (AAV9 virus) are from Addgene.
-
bioRxiv - Neuroscience 2022Quote: ... the adeno-associated virus AAV1.CAG.FLEX.tdTomato.WPRE.bGH (#59462, Addgene, Watertown, MA, USA) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... or control virus AAV-hSyn-EYFP (AddGene, 50465-AAV2, Watertown MA) into the CeA (−1.17 mm AP ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2023Quote: ... and a cre-dependent virus (AAV9-DIO-Ef1a-eYFP, Addgene #27056) were used.
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre or GFP expressing adeno-associated virus (GFP pAAV.CMV.PI.EGFP.WPRE.bGH, Addgene 105530; Cre pENN.AAV.CMVs.PI.Cre.rBG, Addgene 105537) were bilaterally injected into the mPFC of AT2R-flox mice at 2.5mm caudal ...
-
bioRxiv - Neuroscience 2023Quote: ... retroAAV-CAG-GFP (virus made in the host institute, using Addgene plasmid #37825 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mm V) and retrograde AAV-Syn-jGCaMP8f-WPRE virus (Addgene) was injected using a Nanoject ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with virus expressing dCas9-VP64 (Addgene, Watertown, MA), selected using blasticidin (6 – 10 µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... and AAV9-hSyn-EGFP (UPenn Vector Core Cat # AV-9-PV1696) were purchased from Addgene and University of Pennsylvania Vector Core ...
-
bioRxiv - Neuroscience 2020Quote: ... 3.7mm DV from lambda) and 150 nL AAVretro-Ef1a-Cre (Salk vector core, Addgene #55637) into either left zona incerta (–2.03 mm AP ...
-
bioRxiv - Neuroscience 2022Quote: ... Penn Vector Core and Addgene) and fiber photometric (AAV5.Syn-Flex-GCaMP6S-WPRE-SV40; Addgene) experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... EnvA-Rab-pSADΔG-mCherry (Fig. 5A, Salk Vector Core; 1.0 x 109; Addgene plasmid #32636); EnvA-Rab-CVS-N2cΔG-H2B-EGFP (Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/1 (Penn vector core) or rAAV2-retro helper (Addgene, #81070 (Tervo et al., 2016)) ...
-
bioRxiv - Molecular Biology 2023Quote: pcDNA-dCas9-p300 Core plasmids (D1399Y; plasmid #61358 and plasmid #61357) were purchased from Addgene. pSPgRNA (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected AAV5.EF1.dflox.hChR2(H134R)- mCherry.WPRE.hGH (based on Addgene plasmid #20297, UNC Vector Core) cre- dependent virus into the frontal cortex ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentiviral vectors were produced by the Leuven Viral Vector Core using pLenti HsATP13A2 WT (Addgene plasmid #171485 ...
-
bioRxiv - Physiology 2023Quote: ... Male mice were injected intravenously with AAV8.mPcsk9D377Y (Addgene 58376, purified at Penn Vector Core)17 at a dose of 1012 viral genomes per mouse ...
-
bioRxiv - Neuroscience 2022Quote: ... or control virus pAAV-CaMKIIa-EGFP (Addgene Cat# 50469-AAV5, titer: 4.3x1012) into the CA2 using the following coordinates from Bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... The control virus (AAV8-hSyn-DIO-mCherry, 2.3×1013 GC/mL, Addgene) was injected according to the same procedure ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194 ...
-
bioRxiv - Neuroscience 2022Quote: ... a virus expressing GCaMP6s (AAV9.Syn.GCaMP6s.WPRE.SV40, ~1.9 × 1013 GC/ml; Addgene # 100843) was injected unilaterally in the A13 while for DREADD experiments viruses for reversibly activating (AVV8-Syn-hM3D-Gq-mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) was injected 400 μm below the dura (4-10 sites ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 ul of AAV8-hSyn-DIO-hM4D(Gi)-mCherry virus (Addgene, USA) were bilaterally injected into 6 PV-Cre animals bilaterally ±0.5 mm lateral to midline ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5μl pGP-AAVrg-syn-jGCaMP7f-WPRE virus 25 (1.85× 1013GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Neuroscience 2022Quote: ... the virus used was an AAV5-FLOX-ChR2-mCherry (Addgene, #20297-AAV5) or a AAV5-Ef1a-DIO-eYFP (UNC Vector Core) ...
-
bioRxiv - Immunology 2023Quote: ... Fresh virus of (MSCV-myc-CAR-2A-Thy1.1, Anjana Rao, Addgene: 127890) containing chimeric antigen receptor (CAR ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...