Labshake search
Citations for Addgene :
1 - 50 of 361 citations for Mouse Anti Clostridium Difficile Toxin B Antibody TB7 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... a plasmid previously used in Clostridium difficile that contains an aTc- inducible transposase and mariner-based transposon (Addgene 106377) 48 ...
-
bioRxiv - Microbiology 2020Quote: ... described for Clostridium mutagenesis (Addgene 106377) (20 ...
-
bioRxiv - Microbiology 2020Quote: ... difficile (catP in pRPF185, Addgene 106367, from (65)) were PCR-amplified with overlapping primers using Phusion Flash High-Fidelity PCR Master-Mix (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... difficile chloramphenicol resistance cassette (catP in pRPF185; Addgene 106367 49 and the Saccharopolyspora erythraea erythromycin resistance cassette (ermE) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The ‘Cell-free to Clostridium’ vectors were derived from pJL1 plasmid (Addgene #69496), modified in the T7 promoter region to contain a BsaI recognition site between the RBS and START codon in three variations to generate pD1 ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Synthetic Biology 2022Quote: ... or ddGFP-B (Addgene, 40287). cDNAs for the PAR binding domains were amplified from previously published pET19b constructs (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Neuroscience 2021Quote: Tetanus toxin light chain (TeTxLC) was amplified by PCR from pGEMTEZ-TeTxLC (Addgene #32640, (Yu et al., 2004)) using forward primer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PDGF-TMD-GFP plasmid (pFU-no toxin-PE) was a gift from Ines Ibanez-Tallon (Addgene plasmid # 24149) 29.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... PMCA2w/b and GCamP6s (both from Addgene); and DsRedExpress2 (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HiFi SpCas9 (#) HypaR-SpCas9 (Addgene #126757), B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Cell Biology 2023Quote: ... and pUC57-b-globin (Addgene plasmid 194437) have been deposited at Addgene.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFPC1-hVAP-B KD/MD (Addgene – 104450), pEFIRES-P-mTagBFP-KDEL (Addgene – 87163 ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Bioengineering 2021Quote: ... and B-GECO was also obtained from Addgene. MaLionG and mitoMaLionR were generated in the author’s group (T ...
-
bioRxiv - Physiology 2022Quote: ... Fabp4-Flex-DTA transgenic construct was generated by inserting the coding sequence of diphtheria toxin A (DTA) into the pBS Fabp4 promoter (5.4kb) polyA vector (Addgene, 11424), flanked by flip-excision (FLEX ...
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and pSH-EFIRES-B-Seipin-miniIAA7-mEGFP (Addgene #129719) [3,10] ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... HSP104-b/Leu(WT) was a gift from Susan Lindquist (Addgene plasmid # 1156 ...
-
bioRxiv - Plant Biology 2023Quote: ... The B- and C-modules with mTurquoise2 (amplified from an AddGene-derived template (Goedhart et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509; http://n2t.net/addgene:37509; RRID:Addgene_37509), and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3-SARS2-B.1.617.2 (Delta) was a gift from David Nemazee (Addgene plasmid #172320 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-Ef1a-DIO-mCherry (gift from B. Roth; Addgene viral prep # 50459-AAV8)(Krashes et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... PH-PLCδ1-GFP (#51407) and mCherry-VAP-B (#108126) were purchased from Addgene, pTagRFP-C (#FP141 ...
-
bioRxiv - Microbiology 2023Quote: ... pMB1-B-recA was recombined with pMB1-A-pBAD-dCas9 (Addgene number: 190132) in the target plasmid pMB2a-tet (a modified version of Addgene number ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219 ...
-
bioRxiv - Biochemistry 2021Quote: ... pAcGHLT-B-DDB1 (plasmid #48638) and pET28-UBA1 (plasmid #32534) were obtained from Addgene. The pOPC-UBA3-GST-APPBP1 co-expression plasmid ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... unlabeled HeLa-TDS cells were transfected with CENP-B-INCENP-GFP (Addgene, plasmid #45238), and for live-cell imaging also with mCherry-PRC1 plasmid provided by Casper C ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae expression vector (12URA-B) was a gift from Scott Gradia (Addgene plasmid #48304) a plasmid expressing human TOP2α was kindly provided by the James Berger (John Hopkins School of Medicine ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...