Labshake search
Citations for Addgene :
151 - 200 of 10000+ citations for Mouse ATPAF2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al., 2014) + 8 μg pCAG-CyRFP1 (Addgene; (Laviv et al., 2016)) + 4 μg EGFP-N1 or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA + 8 μg pCAG-CyRFP1 + 4 μg shRNA insensitive cofilin1-EGFP (Bosch et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... shRNAs were cloned into the retroviral expression vector LEPG (Addgene_111160) according to the procedure described previously31 ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA sequences were constructed into pLKO-TET-ON (Addgene # 21915). Sequences of sgRNA and shRNA are provided in Supplementary Table 4 ...
-
bioRxiv - Immunology 2019Quote: ... and the two Rictor shRNA vectors were purchased from Addgene. The pEnter/D-TOPO entry vector was purchased from Thermo Fischer ...
-
bioRxiv - Cancer Biology 2021Quote: ... pMKO shRNA Bim was a gift from Joan Brugge (Addgene plasmid # 17235 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a control shRNA (a gift from David Sabatini; Addgene plasmid #1864 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SERPINB3 knockdown cells were transduced with scramble shRNA (Addgene #1684) or SERPINB3 shRNA (Sigma Mission shRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... except for the scramble shRNA which was obtained from Addgene (a gift from David Sabatini ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Developmental Biology 2020Quote: The plasmid encoding for the mouse Dbx2 RNA probe was a gift from Thomas Jessell (Addgene plasmid 16288; 33). Instead ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse PSD95 sequence was a gift from Gary Bassell (Addgene plasmid #102949). TurboID was fused at the C-terminus of PSD95 and inserted into a cre-dependent AAV expression vector under the synapsin promoter by Gibson assembly (NEB) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid MyosinIIA-GFP [23] that encodes for mouse GFP-Myosin9 was a gift from Matthew Krummel (Addgene plasmid #38297).
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... Selected shRNAs were cloned into a modified lentiviral vector (Addgene #12247) using MluI and ClaI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA templates and shRNA oligoes mentioned above were acquired from Addgene or synthesized from BGI (Shenzhen ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs were subcloned into a Tet-on pLKO-puro (Addgene, #21915) via AgeI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pBrain-GFP-shTACC3 shRNA was a gift from Stephen Royle (Addgene plasmid # 59355 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs used were either purchased from Addgene (shCtrl: Addgene #1864) or designed using the Genetic Perturbation Platform.
-
bioRxiv - Immunology 2023Quote: ... The shRNAs were cloned separately into LentiCRISPRv2-GFP (modified from Addgene) and transiently co-transfected with psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into pSIH1-H1-puro vector (#26597; Addgene). cDNA sequences of PAK1 mutants with a C-terminus Flag tag were synthesized at BGI Genomics (Beijing ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Cancer Biology 2021Quote: We generated pX330 Mettl3 vector by cloning the previously described sgRNA targeting mouse Mettl316 into the pX330 plasmid (Addgene Plasmid #42230). The pX330 plasmid was digested using BbsI and a pair of partially complementary annealed oligos containing overhangs from BbsI site and Mettl3 sgRNA sequence were cloned scarlessly into the vector ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Physiology 2019Quote: ... GFP-PGC1 plasmid expressing eGFP-tagged mouse PGC1a was acquired from Addgene(50). For in vivo electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525; http://n2t.net/addgene:45525; RRID:Addgene_45525), pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526; http://n2t.net/addgene:45526; RRID:Addgene_45526), and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control Scramble shRNA sequence (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the same as that from Addgene Plasmid # 1864.
-
bioRxiv - Neuroscience 2021Quote: ... the AAV-shRNA-ctrl was a gift from Hongjun Song (RRID: Addgene_85741) (Yu et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... Control shRNAs targeting luciferase or GFP were previously described (Addgene #83092, #83085) 33.
-
bioRxiv - Neuroscience 2023Quote: ... RSPO2 shRNAs were cloned into the pLentiLox 3.7 lentiviral vector (PLL3.7, AddGene), which co-expresses green fluorescent protein (GFP) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The backbone vector for shRNAs was purchased from Addgene (pLKO.1_mCherry, 128073). We followed the shRNA construction protocol from the Genetic Perturbation Platform web portal (https://portals.broadinstitute.org/gpp/public/resources/protocols) ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527; http://n2t.net/addgene:45527; RRID:Addgene_45527) were gifts from Haining Zhong 73 ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... A cDNA for GFP-tagged mouse septin 6 was obtained from Addgene (plasmid #38296) and cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA construct along with two helper DNA constructs (pHR-CMV8.2 deltaR (Addgene 8454) and pCMV-VSVG (Addgene 8455) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNAs were cloned into Tet-pLKO-Puro (a gift from Dmitri Wiederschain (Addgene plasmid # 21915 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A non-targeting control shRNA vector (sh:SCR) was purchased from Addgene (Watertown, MA). Plasmids were packaged with the third-generation lentiviral packaging system (VSV-G ...
-
bioRxiv - Cell Biology 2021Quote: ... Cloning of shRNAs was conducted according to the pLKO.1 protocol (Addgene 2006). YAP 6SA was subcloned into pLJM1 by PCR amplification using primers (For ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...