Labshake search
Citations for Addgene :
651 - 700 of 10000+ citations for Mouse ATPAF2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... each pLJM1 plasmid was co-transfected with psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Genetics 2023Quote: ... The backbone plasmid was modified from plasmid LentiGuide-Puro (Addgene, 52963), with an addition of a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope plasmids (pMD2.G; Addgene plasmid no. 12259; RRID: Addgene_12259) were originally prepared by the Didier Trono laboratory (École Polytechnique Fédérale de Lausanne ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope plasmids (pMD2.G; Addgene plasmid no. 12259; RRID: Addgene_12259) were originally prepared by the Didier Trono laboratory (École Polytechnique Fédérale de Lausanne ...
-
bioRxiv - Biophysics 2023Quote: ... Anderson Cancer Center through the Addgene plasmid repository (Addgene plasmid #121478). Caveolin-1-EGFP (Cav1-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... mScarlet was PCR amplified from the plasmid pmScarlet_C1 (Addgene plasmid #85042) while also adding a fyn myristolyation sequence (a membrane targeting sequence ...
-
bioRxiv - Genetics 2023Quote: ... and pCas9_GFP plasmid (a gift from Kiran Musunuru; Addgene plasmid # 44719) (Ding et al ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374; http://n2t.net/addgene:145374; RRID:Addgene_145374) was linearized with XbaI ...
-
bioRxiv - Biophysics 2023Quote: ... and pEVOL-pAzF plasmid (gift from Peter Schultz, Addgene plasmid # 31186) 59 ...
-
bioRxiv - Biochemistry 2023Quote: ... The sgRNA was cloned into the pX459 plasmid (Addgene plasmid #62988) and transfected into HeLa cells using JetPRIME (polyplus 114-07 ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRNA cassette was custom-synthesised by GenScript (www.genscript.com) and inserted into into SunTag dCas9 plasmid (Addgene Plasmid #117168) using the KpnI and MauBI restriction enzymes (Thermo Scientific™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmid and the pcDNA3-HA-HIF2α(P405A/P531A) plasmid (Addgene #18956). Modified pLEX vector was used for lentiviral production as controls ...
-
bioRxiv - Cell Biology 2023Quote: The 2nd generation lenti-viral packaging plasmid psPAX2 (Addgene plasmid #12260) was a gift from Didier Trono ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Immunology 2023Quote: ... with the following plasmids: pCDNA3-HA-Akt1 (Addgene plasmid # 73408, RRID:Addgene_73408), pCDNA3-HA-Akt1-aa1-149 (Addgene plasmid # 73410 ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into the Tet-on plasmid TLCV2 (Addgene plasmid #87360) digested with the same enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was produced with the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... The plasmids pAdDeltaF6 (Addgene plasmid #112867; http://n2t.net/addgene:112867; RRID:Addgene_112867) and pAAV2/rh10 (Addgene plasmid # 112866 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid pLX2 is a derivative of pMZ374 (Addgene plasmid ID: #59896)67 in which the Cas9 gene has been removed by EagI digestion ...
-
bioRxiv - Biophysics 2024Quote: ... with 1 [µg] of F-tractin GFP plasmid (Plasmid #58473 Addgene) and the P5 Primary Cell 4D-NucleofectorTM X Kit to then electroporate corresponding to the transfection program (CA-167 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the shCT or the pool of the two ZEB1 shRNA constructs were packaged into second generation virus particles using psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2019Quote: ... or the shRNA control (dsRed2) AGTTCCAGTACGGCTCCAA or (GFP) CAAGCTGACCCTGAAGTTC were first cloned separately into a pSicoR vector (Addgene, Ref. 11579) under the control of a U6 promoter using HpaI and BstEII enzymes then ...
-
bioRxiv - Cancer Biology 2022Quote: ... were purchased from Horizon Discovery while the lentiviral vectors expressing scrambled shRNA (Sarbassov et al., 2005) and flag-tagged DPYD (Shaul et al., 2014) were bought from Addgene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: We cloned shRNAs against SCD and GPX4 as well as control shRNA in the Tet-pLKO-puro vector (Gift from Dmitri Wiederschain, Addgene plasmid #21915 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK 293T derived amphotrophic phoenix cells were transfected by calcium phosphate method with 25μM chloroquine and the corresponding shRNA-targeting MLP vector in combination with psPax2 (Addgene, #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus was produced by co-transfection of the TRIPZ shRNA with pMD2.G and psPAX2 (gifts from Didier Trono, Addgene plasmid #12259 and #12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... the miR-30a-shRNA cassette was then amplified and inserted into pDIO-DSE-mCherry-PSE-MCS (gift from Beatriz Rico (Addgene plasmid #129669 ...
-
bioRxiv - Neuroscience 2023Quote: ... used for M1 knockdown was designed with the TRC algorithm (Broad Institute) and cloned into the pAAV-shRNA-ctrl vector from Addgene. pAAV-shRNA-ctrl was used as the empty vector plasmid in Figure 5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-eukaryotic gene targeting – target sequence: CAACAAGATGAAGAGCACCAA) or shRNA targeting MAT2A (MAT2Ash78 – target sequence: GTTCAGGTCTCTTATGCTATT; MAT2Ash85 – target sequence AGCAGTTGTGCCTGCGAAATA) in a pLL3.7 backbone (Addgene#11795) were packaged in HEK 293T cells as previously described [15] using Turbofect (Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Immunology 2019Quote: ... HEK293T cells were transfected with the respective sgRNA-containing plasmids together with the VSV-G (pCMV-VSV-G) envelope plasmid and dVPR (pCMV-dR8.2) packaging plasmids (from Addgene) using the XtremeGene9 transfection reagent (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... were co-transfected with pLenti plasmids and the packaging plasmids psPAX2 and pMD2G/VSV-G (Addgene Plasmids #12259-60) to produce lentiviral particles ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Molecular Biology 2020Quote: The RAD51 overexpression plasmid (pAB1118) was constructed by cloning RAD51 cDNA into the pCAGGS-mCherry plasmid (Addgene, plasmid #41583). First ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Genomics 2020Quote: ... The LES2A-CRE plasmid was assembled by replacing the XbaI-EcoRI fragment in the lentiCas9-Blast plasmid (Addgene plasmid #52962) (33 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stable overexpression cells were created using Vangl1 and Vangl2 plasmids (Harvard PlasmID repository, HsCD00339551 and HsCD00294893) and Wnt5a plasmid that was a gift from Marian Waterman (Addgene plasmid # 35911 ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293T cells were transfected with the pLenti-VIM plasmid in combinations with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G (Addgene) using TransIT_293 transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2023Quote: HMGB1 plasmids for cell line construction were generated in a 2nd generation pLVX-M- puro transfer plasmid (Addgene plasmid# 125839). The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Bioengineering 2023Quote: ... Each well was transfected with 7.5 μg of one sgRNA plasmid of interest and 7.5 μg of a SpCas9 encoding plasmid (AddGene plasmid# 48137) through the calcium phosphate precipitation method as previously described (31) ...