Labshake search
Citations for Addgene :
1 - 50 of 432 citations for Mouse 20S Proteasome 20S PSM CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: Thermoplasma acidophilium 20S proteasome (pRSF-T20S, Addgene plasmid 110805) was expressed and purified essentially as described previously (55) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pInducer 20 (Addgene). ApoL6 was also subcloned into pcDNA3.1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-TFR-20 (RRID:Addgene_55144) respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... Oligonucleotides with these overhangs and a region complementary to the sequence of GFPnovo2 (in plasmid pSM Addgene) or mKate (in plasmid pCFJ350 Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Beta-Catenin-20 (Addgene plasmid 55001 ...
-
bioRxiv - Neuroscience 2023Quote: ... 28027)20 and Tamotsu Yoshimori (Addgene, 21075)21 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-hsyn-GFP (n=20; Addgene 50465 ...
-
bioRxiv - Cell Biology 2022Quote: The GFP-P2A-FLAG-K(AAA)20-P2A-mKate2 construct was modified based on GFP-P2A-FLAG-K(AAG)20-P2A-RFP (105689, Addgene). For MTS (Mitochondrial targeting sequence)- GFP-K(AAA)20-P2A-mKate2 construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µL of plasmid pMIGR1 (Addgene, cat# 27490) containing the cDNA of HMX3 was combined with 62 µL of 2 M CaCl2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 20% Cre-dependent GCaMP6f (AAV.CAG.Flex.GCaMP6f.WPRE.SV4089; Addgene, #100835). For SK2-KO mice ...
-
bioRxiv - Genomics 2023Quote: ... a Neomycin resistance gene and a negative selection marker expressing tagBFP and was derived from pDONOR-tagBFP-PSM-EGFP (Addgene 100603). Flanking the positive selection cassette ...
-
bioRxiv - Neuroscience 2020Quote: ... or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al., 2014) + 8 μg pCAG-CyRFP1 (Addgene; (Laviv et al., 2016)) + 4 μg EGFP-N1 or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA + 8 μg pCAG-CyRFP1 + 4 μg shRNA insensitive cofilin1-EGFP (Bosch et al. ...
-
bioRxiv - Genomics 2020Quote: ... into either the pcDNA3.1+ (Addgene #V790-20; BamHI/NotI sites) for over-expression or pcDNA4/TO/myc-his-B (Thermofisher #V103020 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Cell Biology 2024Quote: ... YPet-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 56636 ...
-
bioRxiv - Cell Biology 2024Quote: ... mCerulean-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55382 ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293T cells (~20 million) stably expressing pLenti-CMV-puro (Addgene 17452) empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... mApple and TfR DNA was obtained from mApple-Lysosomes-20 (RRID:Addgene_54921) and mCherry-TFR-20 (RRID:Addgene_55144 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and/or a pX330 CRISPR/Cas9 vector (20 μg; Addgene #42230) targeting the respective tumor suppressor genes ...
-
bioRxiv - Cell Biology 2019Quote: ... mTFP1-Lysosomes-20 was a gift from Michael Davidson (Addgene # 55495) (28) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20 µg of the retroviral vectors pMXs-Oct4 (#13366, Addgene), pMXs-Klf4 (#13370 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mCherry-Beta-Catenin-20 (a gift from Michael Davidson; Addgene plasmid # 55001), and pcDNA3-S33Y Beta-catenin (a gift from Eric Fearon (Kolligs et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Princeton University) and high titer Cre-dependent GCaMP6f (20%, AAV.CAG.Flex.GCaMP6f.WPRE.SV40; Addgene, #100835) was injected ∼300μm below the pial surface of medial and/or lateral crus I (∼900nL per site ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments were cloned into the pInducer 20 lentiviral vector (Addgene plasmid #44012) for doxycycline-inducible expression.
-
bioRxiv - Cell Biology 2022Quote: ... tdTurboRFP-Lysosomes-20 were gifts from Michael Davidson (Addgene plasmid # 55246 and 58061). pLJM1-Tmem192-mRFP-3xHA was a gift from Roberto Zoncu Addgene plasmid # 134631 ...
-
bioRxiv - Neuroscience 2022Quote: ... Each individual 20-nucleotide gRNA sequence were inserted into pCFD3 plasmid (Addgene #49410) using the KLD enzyme mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017; http://n2t.net/addgene:54017; RRID:Addgene_54017) were gifts from Michael Davidson.
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Rab5a and mEmerald-Lysosomes-20 were both gifts from Michael Davidson (RRID:Addgene_54243 and RRID:Addgene_54149 respectively).
-
bioRxiv - Molecular Biology 2021Quote: ... pENTR constructs were combined with the expression constructs: pInducer 20 (Addgene plasmids#44012). Plasmids were validated via sequencing (Eton Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble BFP (mTagBFP2) in pcDNA3.1 was derived from mTagBFP2-Lysosome-20 (Addgene #55308). Soluble EGFP (pEGFP-C1 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.7 μl of 20 mg/ml stock of homemade T7 RNA polymerase (Addgene plasmid p6XHis-T7-P266L33 ...
-
bioRxiv - Bioengineering 2023Quote: ... each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA (Addgene 87110). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined) ...
-
bioRxiv - Cell Biology 2022Quote: ... Orai1-GCamp6f was a plasmid deposited in Addgene by Michael Cahalan (Addgene #73564; (20)) ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... and each 20-bp target sequence was subcloned into the pX330 vector (Addgene 42230). The CRISPR/Cas9 target sequences (20-bp target and 3-bp PAM sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-mCherry-WPRE (Addgene 50459 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Cell Biology 2019Quote: ... DHPC-018 cells were infected at passage 20 with lentivirus expressing FUGW-eGFP (Addgene, #14883), then sorted on a FACS Aria II cell sorter for GFP fluorescence ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... with 20 mg Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from Feng Zhang; Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2021Quote: Guide RNAs were designed as 20 bp DNA oligonucleotides and cloned into pX330 (Addgene 42230), and co-transfected with a circular PQR repair template using Lipofectamine LTX (Life Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene 44361 ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 bp CRISPR-Cas9 targets (Table S2) were inserted into the pDD162 vector (Addgene #47549) by linearizing this vector with 15 bp overlapped primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng reference reporter (pcDNA3.1-Nanoluc-3xFLAG-V5) and 50 ng 3xFLAG tagged constructs (Addgene #87063). Transfection was carried out using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Rab5a and mEmerald-Lysosomes-20 were both gifts from Michael Davidson (RRID:Addgene_54243 and RRID:Addgene_54149 respectively).
-
bioRxiv - Cancer Biology 2019Quote: ... Table S2) with a 20-bp targeting telomere sequences (TAGGGTTAGGGTTAGGGTTA) were annealed and cloned into px458 (Addgene) using the digestion sites of BbsI (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2021Quote: A 20 μL reaction containing 150 ng of a plasmid containing two loxP sites (Addgene Plasmid #26852) and 500 nM of Cre or Cre mutants in recombination buffer (50 mM Tris-Cl ...