Labshake search
Citations for Addgene :
401 - 450 of 2504 citations for Monoethyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... In earlier experiments AAV1:CBA:FLEX:Arch-eGFP (200nl;5.48x1012 vg/ml; AV-1- PV2432; University of Pennsylvania vector core, Philadelphia, PA, USA, now at Addgene, 22222 - AAV1) was used ...
-
bioRxiv - Neuroscience 2023Quote: A Cre-dependent inhibitory optogenetic construct halorhodopsin (eNpHR, AAV5-Ef1a-DIO eNpHR 3.0-EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 26966) or an empty vector (control ...
-
bioRxiv - Neuroscience 2023Quote: ... we expressed GCaMP6s by direct microinjection of AAV2/1-hSyn-GCaMP6s-WPRE-SV40 (Addgene, 100843-AAV1, Titer: 2.5×1013 GC/mL) into the visual cortex ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected 100 μL of AAV1.Syn.Flex.GCaMP7b (Addgene, #104493-AAV1) bilaterally into visual area PM (−3.3 mm posterior ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 nl of AAV1-CAG-tdTomato-WPRE-SV40 (Addgene, 105554) was injected in POm (AP −2.06 ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... retrograde (1E12 GC/mL, Addgene 55637 ...
-
bioRxiv - Neuroscience 2020Quote: AAV-SYN-flex-PSAM4-GlyR-IRES-EGFP was a gift from Scott Sternson (Addgene viral prep # 119741-AAV5; http://n2t.net/addgene:119741; RRID:Addgene_119741; >1×1013 vg/ml). Control virus was AAV1-EF1α-DIO-eYFP (>1×1013 vg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... the adeno-associated virus AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of mKif6 FL (1-803aa) and ML (360-803aa) were subcloned into pmCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563). mCherry was removed and mKif6 (1-493aa)-mNeonGreen was added into pmCherry2 vector ...
-
bioRxiv - Neuroscience 2023Quote: Calcium indicator expression in vLGN/IGL neurons was achieved with AAV-hSynapsin1- FLEx-axon-GCaMP6s (1 × 1012 genome copies per ml, Addgene, 112010-AAV5) for retinal expression AAV2.7M8-syn-GCaMP8m viral vectors (1 × 1013 genome copies per ml) ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...